Клещенко Елена: другие произведения.

Файлы Сергея Островски

Журнал "Самиздат": [Регистрация] [Найти] [Рейтинги] [Обсуждения] [Новинки] [Обзоры] [Помощь]
Реклама:
Новинки на КНИГОМАН!


Оценка: 8.24*8  Ваша оценка:

  
  Коллегам из "Химии и жизни"
  и всем научным журналистам;
  спасибо за информацию о будущем.
  
  Убийство в салоне красоты
  
  2077/06/18, 9:30
  Детектив сидел на лестнице, прямо на бетонной ступеньке, с лаптопом на коленях. У щеки чернел микрофончик: шеф отдавал команды флайботам, ведущим видеосъемку. Детектива звали Сергей. Не Серж, а именно Сергей. Лет под тридцать, тощий и долговязый, черные волосы связаны на затылке в хвост. Фред поступил в его распоряжение позавчера, а сегодня, не успел войти, - доброе утро, у нас убийство, через минуту выезжаем.
  Фред Харпер, стажер в отделе по расследованию убийств, присел на корточки у начальства за спиной и стал смотреть на экран. Сергей этого не запрещал, даже настаивал, чтобы стажер сам держался в курсе дела.
  Экран был разделен на шестнадцать прямоугольничков, и каждый жил собственной жизнью, меняя крупные планы на общие, кружась и замирая. У Фреда заломило во лбу, он моргнул пару раз и принялся рассматривать кадры по отдельности. Камеры нижнего ряда парили над самым полом: дорогая имитация дерева, пестрый ковер с разноцветным геометрическим рисунком. В кадр попала полупрозрачная кисть руки - убранное тело уже заменили голограммой. По-детски тонкие пальчики, оранжевый лак на овальных ноготках... Камера заскользила вдоль руки, и Фред отвел глаза: еще раз видеть лицо не хотелось.
  В среднем ряду мелькали стулья и пуфики, в верхнем - окно, подоконник, рабочий столик убитой. Прозрачные флаконы с лаками и красками всех цветов радуги, узорные штампики, стразики, трафаретки, подушечки, пилочки, палочки, щипчики... Шеф бубнил в микрофон: "Седьмой, стоп, два дюйма на пять часов и так остался. Четвертый, о-кей, продолжение программы. Седьмой, крупный план, самый крупный. Сохранить, продолжение..." Экранчики в разных ракурсах показывали предмет, лежащий на ковре: герметичная капсула с ярким цветком орхидеи, размером со сливу.
  Было слышно, как у дверей переговариваются полицейские. "Может, она и не по нашему отделу? - Фигня. Не слышал, что доктора говорили: паралич дыхательных центров. А девочка молодая, ничем не болела. Нейроствол, это я тебе скажу и без всяких долбаных экспертов. - Да за что ее так? - А вот этого я тебе не скажу, тут эксперт нужен".
  - А-га, - сказал шеф. - Седьмой, шестой, стоп. Свет-один, вниз до нуля, максимальная яркость. Чуть назад и повернись по часовой стрелке... Фред, смотри сюда. Что видишь?
  Стажер уставился на участок ковра. Посередине ворсинки слегка приглажены, образуя...
  - След?
  - След от волочения. Тело подтащили к двери, там и оставили.
  - Зачем?
  - Чтобы открыть замок ее пальцем. Тут двусторонние замки с папиллографом, настроены на всех сотрудников. Тебе задание: когда получим доступ к их компьютеру, сразу скопируй протоколы "смартхоума" и сопоставь с показаниями свидетелей.
  
  9:46
  Перепуганные мастера из "Салона Джоса и Ангела" рассказывали примерно одно и то же. Накануне вечером, в начале десятого, все они - четыре парикмахера-стилиста, два косметолога, два визажиста, мастера по боди-арту, массажисты - один за другим ушли. Жертва, нейл-мастер, Джорджина Риан двадцати четырех лет, задержалась: сначала сказала, что забыла выключить подогрев в ванночке, потом - что не закрыла флакон с осушителем, потом еще что-то... Мисс Шу, администратор, допускала, что Джорджина специально хотела остаться одна. Она раза три спохватывалась и возвращалась, это выглядело немного странно. Утром уборщик нашел ее: ничком на ковре, возле входной двери. Непосредственной причиной смерти была остановка дыхания. С очень высокой вероятностью можно предположить применение волнового оружия, воздействующего на нервную систему.
  Компьютерная программа, управляющая настройками помещения, все подтвердила. Накануне вечером после девяти дверь открывалась и закрывалась несколько раз подряд. В промежутке между последним и предпоследним открыванием двери (21:14 - 21:28) "смартхоуму" поступили три голосовых команды: "зеркальность окон максимум", "освещение в зале яркость три", "освещение минимум". И затем - "входная дверь, Дж. Риан" - папиллографу все равно, касается ли его рука живого человека или мертвого.
  Журнал регистрации был любопытнейшим документом. И пришедшие впервые, и постоянные клиенты звались уменьшительными именами и прозвищами - Клаус, Марго, Анджали, Тим, Алекс, Лила, другой Алекс, Ояма, Борис, Банни, Симо... - всего около восьмидесяти человек за день, ничего себе камерный салон для избранных. (Впрочем, цены на услуги подтверждают, что именно для избранных, а не для всяких-разных.) Личности пришлось устанавливать по номерам кредитных карт. Зато для каждого клиента были известны процедуры, время, в которое они проводились, а также имена мастеров и приблизительное время ухода. Кроме посетителей, в число подозреваемых попали все мастера и курьер, привозивший им обеды.
  С администратором детектив беседовал сам. Кэтрин Шу, по документам тридцать лет, на вид двадцать с небольшим, медноцветные кудри, полный макияж, невзирая на время суток и ситуацию. Тушь для ресниц, очевидно, водостойкая.
  - Мисс Шу, когда вы уходили, а Джорджина осталась последней... нет, давайте не будем снова плакать... кто-то еще находился в салоне. Подумайте, как это могло произойти?
  - Н-не знаю... нет, правда не знаю. Когда мы записываем клиента на прием, мы выдаем ему карту, она работает на вход и на выход в день записи, а в девять вечера, когда кончается прием, аннулируется. И за уходящими я всегда слежу, среди наших клиентов бывают... ну, понимаете, несколько нестабильные, особенно среди людей искусства... я всегда слежу, чтобы человек покинул салон.
  - Но вы не можете видеть входную дверь, когда сидите за барьером?
  - Нет, но... От замка приходят сигнал на главный компьютер. И потом, у нас на двери колокольчик. Такой, старинный, который сам качается и звонит, когда дверь открывается, я слышу. Если клиент пошел к выходу, а колокольчик не звякнул, я выхожу и спрашиваю, могу ли чем-нибудь помочь.
  - Я понял. А если колокольчик звякнул, а клиент не ушел?.. Ну-ну, мисс Шу, погодите, никто вас ни в чем не обвиняет. Такое могло случиться?
  - Наверное, да...
  - Я тоже так думаю. Он мог активировать замок, приоткрыть дверь, но не выйти. Теперь, куда ведет боковой коридор справа?
  - В холл для персонала. Там кресла, мониторы, фонтанчик - чтобы наши сотрудники могли отдохнуть, когда нет заказов. Но на самом деле он почти всегда пустует. Мы очень востребованы, у нас все мастера расписаны по часам.
  - И клиенты об этом знают?
  - Конечно! Я всегда напоминаю, что записываться к нам нужно заранее.
  - Таким образом, убийце было известно, что там никого не будет. Он или она прощается с вами, открывает дверь, звякает колокольчиком, поворачивает в коридор, заходит в холл для персонала и прячется, скажем, за развлекательный центр. Возможно, он сделал это и с ведома Джорджины - допустим, она действительно хотела остаться с ним наедине. Если специально не искать, никто его в холле не увидит, я правильно понял? Ведь уборщик приходит утром?
  - Да... Господи, какой ужас! Я теперь буду бояться...
  - Установите видеокамеры - кстати, почему их у вас нет?
  - Вы думаете? Но клиенты будут недовольны, корректировка имиджа - частное дело.
  - Что ж, вам виднее. Спасибо, мисс Шу.
  
  
  10:15
  Эксперт - руки в латексных перчатках, на лице маска - поднял к глазам миниатюрную пластиковую пробирку с крышкой, зажав ее между большим и указательным пальцем. Взглянул на круглую прозрачную каплю.
  - Начинай, Адам.
  Роботов, выполняющих подготовку биопроб к анализу, по вековой традиции называли Адамами. Там, где не надо думать, робот лучше человека: не ошибется, отмеряя аликвоты, не перепутает пробирки, не натащит в пробы собственных ферментов и нуклеиновых кислот, за полным неимением... Эксперт тем временем настраивал программу поиска. Закончив, не удержался и заглянул в окуляры микроскопа.
  Десятки ячеек, и каждая подмигивает флуоресцентными вспышками, и каждая вспышка соответствует "букве" ДНК. Будто жильцы большого дома все одновременно решили поиграть в Шерлока Холмса и передают сигналы световым кодом. Окуляры были всего лишь средством выявить очевидные сбои: последовательность букв фиксировал электронный глаз, подключенный к компьютеру.
  Первые последовательности начали возникать в окне результатов, и эксперт немедленно запустил поиск. Эксперт был гражданским лицом, работал на полицейский департамент по контракту. Но каждый раз (пусть об этом никто не знал) он волновался.
  В графе "найдено" высветилось ярко-зеленое "AMELY Chr. Y p11". Эксперт хлопнул в ладоши и потер руки.
  - Первый шаг навстречу Разрушению, - промурлыкал себе под нос. Он с детства любил Альфреда Бестера.
  
  
  10:52
  Сергей и генный эксперт Брук звали друг друга просто по именам.
  - Привет, Мартин. Чем-нибудь порадуешь?
  - Попробую. Отпечатков пальцев нет. То есть их много, но, сам понимаешь... Сумочку и вифон девушки посмотрели, браслет на ее левой руке тоже: никаких следов, похоже, убийца был в перчатках. Однако! Жертва швырнула в него капсулой ароматизатора в упаковке. И попала, причем в лицо. Нам повезло: у них ночью автоматически включается стерилизующий ультрафиолет, но капсула упала нужной стороной вниз. Жалко, что крови нет, зато мазок слюны бесспорный, я там тебе написал...
  - Короче?
  Эксперт развел руками.
  - Получена ДНК. Это хорошая новость.
  - Давай плохую.
  - В количестве семи пикограммов.
  Сергей произнес одно непонятное слово. Негромко, но с сердцем.
  - Меньше генома! Фоторобот не получится?
  Эксперт молча покачал головой.
  - Но ты хоть что-нибудь вытянул?
  - Что-нибудь вытянул, - согласился эксперт. - Образец принадлежит мужчине, это без вопросов: и по амелогенину, и по другим маркерам. Темные глаза, темные волосы - не светлее темно-русого. Про телосложение, рост не рискну высказываться. Раса белая... главным образом белая. Так как геном не полон, не могу исключить со стопроцентной гарантией прабабушек-прадедушек других рас, но все исследованные участки скорее типичны для европейцев. Есть генные комплексы, в высшей степени характерные для юга Европы.
  - Мужчина, скорее всего, белый, волосы темные, глаза темные, возможно, итальянец, грек...
  - ...Француз, швейцарец или внук швейцарца, итальянца или француза. Или правнук, чтобы уж подстраховаться - но не дальше правнука. Сам он при этом может называть себя и шведом, и поляком. Где гены, а где гражданство...
  - М-да. Ну хоть что-то.
  - Дай мне генпаспорта фигурантов, - без выражения сказал эксперт, - через двадцать минут дам тебе девяносто девять процентов.
  - Еще что-нибудь тебе дать? - Это не было приглашением делать дополнительные запросы.
  - Нет, в самом деле: никак нельзя, что ли? У вас убийство, если ты не заметил!
  - Теоретически можно. Но необходима веская причина запрашивать генпаспорт у конкретного человека. Иначе... Наши подозреваемые люди богатые, у всех хорошие адвокаты. Совать нос в их геномы - это может дорого обойтись. Делать придется наоборот: наберем улик, а тогда уже попросим у подозреваемого ДНК или генпаспорт.
  - Угу. А ты не можешь как-нибудь так... - эксперт сделал неопределенное веерообразное движение пальцами.
  - За "как-нибудь", - веско произнес Сергей, - кому-нибудь будет обидно и горько. Меньше смотри сериалов.
  - Ясно. Тогда берись за честный труд. Удачи.
  
  
  11:10
  За честный труд в итоге пришлось взяться стажеру: Сергей уселся просматривать отснятые материалы и протоколы. Мужчин среди подозреваемых оказалось тридцать два. Фред ввел параметры, полученные от генэксперта, и запустил сортировку. Жалко, что преступник не рыжий. Или не японец - их всего двое...
  - Эй, молодой человек, ты что делаешь?
  При других обстоятельствах Фред объяснил бы этому русскому, что подобное обращение есть преследование по возрастному признаку.
  - Выполняю приказ.
  - Останови.
  Сергей подъехал на кресле поближе и неодобрительно щелкнул языком - еще одна его кошмарная привычка.
  - "Темные волосы" ввел? Молодец. Лысого верни. (Палец Сергея подцепил фотографию старого хрыча и перетащил по экрану обратно к подозреваемым.) Бритого верни. (Та же операция.) Седого верни. Крашеного...
  - Я понял.
  - Хорошо. Так, а вот этого конопатого я бы пометил вопросом, что-то непохоже, что он от природы брюнет. А это... у-упс. Хм... (Пол-лица покрыто изящными завитками татуировок, видимые участки кожи - коричневые от загара, вместо волос плюмаж из синих страусовых перьев, радужные контактные линзы, серьга в носу, бриллиант в зубе.) Слушай, а это точно человек? (Фред, опешив от такой нетолерантности, промолчал.) Хочу сказать, это точно белый мужчина?
  - Точно. Постоянный клиент, имя - Джузеппе.
  - Ничего не значит. Я знал девушку по имени Рональд.
  - Был в интимной связи с Элен Ванг, массажисткой.
  - Тоже, если подумать...
  - На шее отчетливо видно адамово яблоко, - потеряв терпение, сказал Фред.
  - Другое дело. Да, этого надо оставить. Работай дальше, только вручную, о-кей?
  ...После того, как подозрения были сняты с блондинов, рыжего, японцев, китайцев, конголезца и двух афроамериканцев (взглянув на фото последних, Мартин подтвердил, что убийца - если и мулат, то куда более светлый), в папке осталось три ряда фотографий, по четыре в каждой. Конечно, уже не восемьдесят, но все еще многовато.
  - Отлично, - сказал Сергей. - Теперь дай мне список по именам, отложим тех, кто приходил с утра. В середине дня сотрудники по очереди устраивают себе короткий перерыв. Многие сидели в этом холле, ходили туда-сюда - вряд ли убийца стал бы так рисковать. Хотя... Ладно, во всяком случае, начинать надо с вечерних посетителей.
  
  
  11:55
  "Утренних" клиентов переместили во вторую очередь, у троих "вечерних" оказалось надежное алиби на начало десятого: танцевали на сцене, в реале, на глазах у сотни зрителей. К полудню на мониторе Фреда красовались всего три фотографии. Тот самый фрик с синим ядерным взрывом на голове. Худощавый молодой человек в галстуке с логотипом фирмы, темные волосы гладко зачесаны назад. Мужчина под пятьдесят: проседь в черных волосах, крупные черты лица, обаятельная улыбка. Фред ткнул пальцем в первое фото, выводя личную информацию.
  - Джузеппе Мауро, тридцать один год, профессия - ай-джей, ник Зепо-Зепо. В момент убийства был у себя дома. Из салона ушел около 17-45. А пришел к открытию, в девять утра.
  - Что они с ним делали столько времени?
  - Посмотри в файле, я понял не все. Прическу делали, старый бодиарт выводили, новый наводили и закрепляли - это то, что понял. Маникюр делали, помпезный и особенный, судя по цене. В детали я не вникал, но работала Джорджина. По генетике подходит: итальянцев среди его предков больше, чем всех других национальностей, не считая латино.
  - Ясно. Следующий?
  - Саймон Герхарт, старший менеджер компании "Софт-Клининг", в момент убийства предположительно направлялся из офиса домой. Стрижка, маникюр. По эмоциональному сообщению мисс Шу, "вел себя как сволочь": придирался к Джорджине, дважды нажал кнопку "минус". Из салона ушел около 18-30. Дед по материнской линии - француз из Марселя.
  - Ты уже и генеалогии собрал?
  - Открытые источники. До четвертого поколения, мистер Брук сказал, дальше не надо. А третий, между прочим, Гэри Карпентер. Не узнал его сразу.
  - А надо было узнать?
  - Карпентер - кандидат в мэры от оппозиции, - преувеличенно вежливо сообщил Фред.
  - Думает выиграть?
  - Я не аналитик, но моим родителям он нравится. Добро, порядок и семейные ценности, беспощадная борьба с преступностью, все такое.
  -Ладно, буду иметь в виду. И что с ним?
  - Был дважды, делал маникюр и стригся. Во второй раз покинул салон около семи вечера, то есть позже всех. Предков из Южной Европы я у него не нашел, до четвертого колена только выходцы из Британии.
  - А почему "был дважды", он что, уходил и снова пришел?
  - Да, мисс Шу говорит, после маникюра он извинился и вышел, вернулся через четверть часа. Но, кстати, и Мауро тоже выходил обедать.
  - Понял. Теперь я тебе расскажу, что успел. В поясной сумочке у жертвы был вифон. Среди исходящих четыре интересных: на один и тот же номер, три раза в течение недели - "нет", "сегодня нет", "прости не смогу" и вчера в полпятого - "да". И этот же номер - во входящих звонках, дважды, уже после убийства. Входящих сообщений с этого вифона, что примечательно, нет. Чей номер, я выяснил: некто Эстон Браун, корреспондент новостного портала "Пасифик дейли". В наш салон не ходил, уровень доходов у него, пожалуй, не тот. Бери его и Мауро, а я возьму Карпентера и еще Герхарта - про него два свидетеля сказали, что к покойной он придирался не просто так... Скачивай коды, адреса - и вперед. Будут отнекиваться - беседуй по вифону, но лучше лично. "Пуговицу" включай на запись, не забудь.
  
  
  14:40
  Беседы со свидетелями и подозреваемыми Сергей и Фред просматривали вместе. Разноцветные линейки индикатора внизу экранов показывали наиболее вероятные эмоции собеседника, как их вычислял компьютер по интонациям и мимике. Сергей сказал, что врет эта программа иной раз по-черному, но все же запустил ее.
  
  Журналист Эстон Браун, загорелый, со светлыми взъерошенными волосами, держался бодро и деловито, но судя по опухшим подглазьям, ночь он не спал или спал мало. Квартира его была нарочито неуютной, как у многих из тех, кто большую часть жизни проводит в Сети, а все украшения и ценности держит в компьютере. Стены сумеречно-синего цвета, нигде ни картины, ни TV-монитора. Мебель удобная, качественная, но будто бы вся одновременно закуплена на распродаже.
  Сославшись на беспорядок в гостиной, Браун провел Фреда в кабинет-спальню. Действительно, там хаос ограничивался рабочим столом, который почти полностью скрывали активированные электронные страницы и планшетки для записей. Тут же стояла недопитая банка энергетика.
  - Добрый день, мистер Браун. Офицер Харпер, полицейское управление. Вы были знакомы с мисс Джорджиной Риан, нейл-мастером из "Салона Джоса и Ангела"?
  - Да, я был с ней знаком, - журналист втянул воздух сквозь зубы, словно ощутив внезапную боль. - Я уже знаю, видел в Сети... Я ей звонил вчера, вифон не отвечал. Я решил, что она передумала... ну, знаете, она согласилась поужинать со мной, но не пришла. Больше я не стал звонить. Решил не терять лицо, сел работать. А с утра, когда получил дайджест блогов, вижу, в "происшествиях" пишут ее подруги... - Браун замолчал и с силой потер пальцами глаза, потом оперся на стол, где тут же вспыхнули "заснувшие" окна.
  - Вы были близки? - спросил Фред. В четырех окнах были тексты и таблицы, в пятом - фотография, окаймленная рисованной рамкой. Джорджина Риан, смеющаяся, в фиолетовом платье с золотистой эмблемой салона - силуэтик Будды и два распростертых крыла... Браун рассеянно сдвинул страницы так, чтобы они закрыли фото.
  - Что, близки?.. Нет, я только ухаживал за ней. Джорджи такая... солнечная девушка. Ну да, я... был влюблен, наверное... Хотя никогда не говорил о ней с коллегами, они бы меня со свету сжили. Представляете, все эти шуточки про интеллектуалов и плебеев... Дурак. Может, она замечала это и поэтому не хотела...
  Он замолчал, потом добавил невыразительным тоном, как бы про себя:
  - Полно срочной работы, а то бы я принял снотворное. Надо поспать.
  - Простите, мистер Браун, я понимаю, как вам тяжело. Но позвольте задать вам еще несколько вопросов.
  - Да, пожалуйста.
  - Как вы, наверное, поняли, мы осмотрели вифон Джорджины. Она отвечала на ваши приглашения, но почему-то стерла все сообщения от вас. Вы можете объяснить, почему?
  Браун слабо улыбнулся.
  - Их не было, офицер. Я писал записки на бумаге, в старинном духе. Надеялся, ей это понравится. - Он взял со стола тонкий маркер и блок желтоватых листков. - Вот, возьмите. Если найдете такие же... у нее дома...
  - Последний вопрос: нет ли у вас предположений о том, кто мог совершить убийство? Не рассказывала ли вам Джорджина о каких-нибудь своих конфликтах, возможно, о других мужчинах?
  - Ничего конкретного. Говорила, что некоторые клиенты с ней заигрывают, делают разные предложения - она считала, я смешной, когда злюсь. Но имен не называла.
  
  Джузеппе Мауро, также известный как Зепо-Зепо, не отвечал на звонки, пришлось навестить его без предварительной договоренности. На сигналы дверного звонка тоже никто не отзывался минут пять. Наконец на двери засветился экран переговорного устройства, явив синие космы и сверкающую улыбку ай-джея.
  - Что тебе нужно, деточка?
  - Задать вам несколько вопросов по поводу убийства Джорджины Риан из "Джоса и Ангела", - злорадно произнес Фред, предъявляя видеокамере полицейскую карточку. Дверь открылась мгновенно, но он еще успел заметить на экранчике, как исчезает улыбка.
  Мауро запахивал на груди халат тигровой расцветки. Сейчас он выглядел не таким чокнутым, как на фото и в видеозаписях, может, потому, что в глазах у него не было этих дурацких радужных линз. Глаза оказались светло-карими и смотрели совершенно трезво.
  - Повторите, пожалуйста, офицер. Маленькую Джину убили?
  - Вчера, около девяти.
  - Ох, намамидабудда... Но... она же мне только вчера работала ногти... - Красавец согнул пальцы, оглядывая крючкообразные когти кобальтового цвета, потом растерянно перевел взгляд на Фреда.
  - Когда она делала вам маникюр, она была еще жива, - успокоил его Фред. Зепо-Зепо, не оценивший полицейского юмора, отчаянно замотал головой (лес синих перьев закачался, как от бури).
  - Ужас, ужас... Пойдемте, присядем на что-нибудь, вы мне все расскажете.
  Нет уж, деточка, это ты мне все расскажешь, подумал Фред.
  Студия соответствовала хозяину. Здесь была и статуя индийской танцовщицы, обтянутая гигантским антикварным презервативом, и куча пестрых шкур на полу, и карминно-красная барная стойка, и кресла в форме розовых рук - сидеть предлагалось на пухлых ладошках, и доска для дартса - большая, в человеческий рост, с человеческим силуэтом. Две стрелки торчали на месте глаз, третья - чуть ниже пояса.
  - Джина, детка... Понимаете, я хожу в этот салон уже три года. Я хорошо ее знал, как и остальных девушек...
  - Можно уточнить, насколько хорошо вы ее знали?
  - Насколько хорошо? - Ай-джей свел густые брови, словно над чем-то серьезно задумался. Если смотреть на его левый, нетатуированный профиль, он казался почти обычным человеком - смуглый красавец-латино, ранние тонкие морщины на подвижном лице. - Ну, я думаю, что... А-а! Да, мы с ней трахались, вас ведь это интересует? Но давно и всего два раза. Последний раз зимой прошлого года, как раз был Валентинов день, ее что-то огорчило, и я... Ну что вы так смотрите, офицер? Это то, чего от меня ждет аудитория. Я человек-подарок, человек-мечта. Вот вы - человек-правосудие, а я человек-мечта. Такая работа. Вообще, я и с Элен, и с Гердой, и с Фэй... нет, с Фэй еще нет... Короче, у меня со всеми девочками очень хорошие отношения.
  - Не сомневаюсь. Она вам не рассказывала, не было ли у нее в последнее время каких-нибудь конфликтов, огорчений? Не обижал ли ее кто-то или, наоборот, обижался на нее?
  - Тот важный тип из "Софт-Клининг", Саймон Как-Там-Дальше,- немедленно ответил Зепо-Зепо. - Что за фирма, не знаю, компьютинг или пылесосы. Все девочки об этом говорили. И обижался, и обижал. Звал Джину поужинать, она отказалась. Он как не понял, снова позвал, она снова отказалась. И больше он ее не приглашал, а каждую неделю записывался к ней и каждый раз жаловался на обслуживание. Наверное, хотел, чтобы у нее накопилось достаточно минусов для увольнения, такая офисная месть - ха! (Ай-джей сделал неприличный жест - благодаря маникюру получилось устрашающе.) Я каждый раз ставил ей два плюса.
  
  По номеру кандидата в мэры отвечал автоматический секретарь ("Оставьте, пожалуйста, ваши данные, и мистер Карпентер свяжется с вами в течение суток"). К счастью, тупое устройство отреагировало на "приоритет ноль", Карпентер отозвался сам и сразу же пригласил детектива зайти.
  Узнав причину визита, кандидат в мэры притушил предвыборную улыбку и опечалился - пристойно и умеренно, однако, по мнению компьютера, искренне. Стол у него в кабинете стоял совсем не такой, как у журналиста - натуральное полированное дерево в тон обивке на стенах, никаких встроенных тач-скринов и клавиатур. Электронные страницы и накопители на этом обширном столе были разложены ровными рядами, а на углу приютилась чашка с засохшей кофейной гущей.
  - Господи, какой кошмар. Знаете, мистер Островски, иногда, когда я просматриваю ленту происшествий, начинаю думать: зачем я ввязался в это дело с выборами? Если нам улыбнется удача, то с момента вступления в должность отвечать за все это буду я.
  - Я думаю, мэр первым делом спросит с полицейского управления, - улыбнулся Сергей. - А мы, конечно, попросим вас о содействии.
  - Спрашивайте, я постараюсь помочь. Единственное, если вы не возражаете - когда будете давать пояснения для прессы, не упоминайте моего имени.
  - До пояснений прессе пока далеко, но я буду иметь в виду. Вы хорошо знали Джорджину Риан?
  - Эту девушку? Нет, совсем не знал: вчера увидел ее впервые. Я раньше не посещал этот салон, ходил стричься в ближайший к моему дому. Я не ценитель этих услуг, ничего в них не понимаю.
  - Можно узнать, почему вы все-таки пошли к "Джосу и Ангелу"?
  - Потому что сегодня я участвую в пресс-конференции. Мне объяснили, что я должен буду выглядеть безупречно, по высочайшим стандартам, и обычной стрижкой не отделаюсь. Посоветовали сделать маникюр, отполировать ногти - руки будут снимать крупным планом. А я даже не знал, что мужчинам это делают! - Карпентер улыбнулся и тут же снова помрачнел. - Пока никаких предположений, кто мог это совершить?
  - Пока только предположения. Еще один вопрос: свидетели сказали, что вы покидали салон и возвращались.
  - Да, мне позвонили из штаба партии. Наверное, можно было пригласить человека зайти в салон, но, откровенно говоря, мне было не совсем удобно в этой обстановке. Я предпочел выйти и переговорить с ним в машине.
  - О чем был разговор?
  - Я бы предпочел не отвечать, это наши внутренние дела.
  - Простите, но я вынужден спросить, где вы находились вчера с девяти вечера до полдесятого.
  - Никаких извинений. Я был у себя дома, просматривал почту. Если нужно, могу прислать копию протокола домового компьютера.
  - Спасибо, это было бы неплохо. Последний вопрос: вы ни с кем не общались в это время? Лично, телефон, чат?
  - Нет, к сожалению.
  - Жаль. Что ж, спасибо, мистер Карпентер, что уделили мне время.
  
  Саймон Герхарт встретился с Сергеем в кафе возле своего офиса. Заказал себе стакан негазированной воды, демонстративно взглянул на часы. В жизни он выглядел постарше, чем на фотографии, темные тщательно приглаженные волосы заметно редели. Идеальный костюм, тот же галстук с логотипом фирмы, руки в модных перчатках.
  - Убита? Что ж, закономерный итог.
  - Итог чего?
  - Неразборчивости в выборе знакомых.
  - Кого вы имеете в виду?
  - Никого конкретно. Но, видите ли, по девушке было заметно, что она... не слишком разборчива. - Герхарт скривил рот. Губы у него были толстые, слегка вывернутые.
  - А подруги считали ее разборчивой...
  - Что?!
  - Правда ли, что вы ухаживали за Джорджиной Риан?
  - Кто вам это сказал?
  - Свидетели. Мистер Герхарт, идет расследование убийства.
  - Ну что ж, я вам отвечу. Девушки этого сорта зачисляют мужчину в трофеи, как только он заговорит с ними чуть менее официально. Однако между нами ничего не было, могу повторить это под томографией.
  (Верю и без томографии, подумал Фред и посмотрел на шефа: тот ухмыльнулся и кивнул. Понимаю выбор девушки, лучше уж синеволосый фрик, да и журналист кажется славным парнем...)
  - Вы всегда носите перчатки?
  - Это нормальное поведение современного человека. (Герхарт покосился на руки детектива и дернул губой.) Никогда не знаешь, с чем придется столкнуться в течение дня. И с кем.
  Он допил воду, поставил стакан на стол. Не спуская глаз с Сергея, извлек из кармана пачку дезинфицирующих салфеток. Вытянул одну, с силой протер край стакана, использованную салфетку аккуратно сложил и убрал в карман.
  - Где вы находились вчера с девяти до полдесятого вечера?
  - Ехал домой. Это все? До свидания.
  
  15:18
  - Ну, как твои впечатления? - спросил Сергей. После просмотра они вместе отправились пообедать, потом взяли по кофе.
  - У Герхарта был мотив, - осторожно сказал Фред. - Но... не знаю. Прийти в салон с оружием, постричься, сделать маникюр, да еще при этом издеваться над девушкой, которую собрался убить, жаловаться на плохое обслуживание...
  - Согласен, нетривиальное поведение. Но кто их знает, этих скромных офисных принцев... Герхарт самолюбив и злится на нее даже сейчас, это видно. А как насчет ай-джея?
  - Ревность как мотив тут, по-моему, не прокатит. Он мне показался вполне нормальным - ну, то есть в реальной жизни, а не когда танцует и все прочее. И компьютер не возражает.
  - Может ли быть вполне нормальным человек, который выглядит как он?
  - Извините, Сергей, в вас говорят гены русских тоталитаристов. Ай-джеям за их вид платят хорошие деньги. Именно за то, чтобы они в реале выглядели, как...
  - Понял. Но, как нам недавно объяснили, творческие личности бывают психически нестабильными. Скажем, если девушка нанесла ему лак не того оттенка...
  - Не очень смешно.
  - А я и не шучу. Я расследовал дело о причинении тяжелого увечья, где мотивом оказался незакрытый тюбик зубной пасты. Все на свете бывает. Потом, этот дартс у него в студии - может быть, просто эпатаж, а может быть, и симптомчик... Хотя... такие когти, как у него, по-моему, со стрелковым оружием несовместимы. Хорошо, идем дальше. Карпентер?
  - Мотива не вижу. Если он действительно впервые в этом салоне - это же легко проверить - и действительно раньше ее не знал...
  - А вот это проверить не так легко. Но я посмотрел, что пишут о нем противники. Не в официальных изданиях, а в комьюнити для неформального общения, где собирают и обсуждают сплетни. Так вот, по Карпентеру - о девочках и прочем разврате ни слова. Одевается он безвкусно, произношение смешное, сказал какую-то глупость про реформу образования... Но никаких оргий с ваннами из шампанского, вообще никакого компромата, кроме консерватизма и занудства, что и не компромат вовсе, а оправдание надежд избирателей... Кажется, и вправду не любитель красивой жизни.
  - Или же он очень хитрый.
  - Откуда в тебе столько цинизма, молодой человек? Нет, ты прав. Но в любом случае, причем тут маникюрша? Не была же она его любовницей, это давно бы всплыло. А хотя бы и была, не такой это огромный грех даже для республиканца, чтобы сразу убивать ее. И вообще, зачем убивать?.. Но с другой стороны - журналист?
  - А что журналист?
  - Чего он боялся? Если комп не врет, он все время трясся, когда разговаривал с тобой.
  - Обвинения в убийстве боялся. Он же не знал, что блондинов мы не подозреваем. А к тому же он пил энергетик. Повышенная возбудимость может дать ошибку при анализе эмоций?
  - И поэтому он тебе сказал, что не говорил коллегам о Джорджине?
  - Ну...
  - Ведь ты его не спрашивал, говорил он кому-то о ней или нет. А он сам выдал ответ на вопрос, почему никто не знал о его романе. Может, конечно, был вне себя и лепетал что попало. А может, никакого романа не было, чисто деловые отношения? Украсить ее фотографией рабочий стол можно за три секунды, сам понимаешь... Кстати, и в салоне никто не вспомнил о Брауне, все говорили только о Герхарте. Заметь: корреспондент крупнейшего новостного портала побережья упорно и красиво ухаживает, засыпает нашу девочку бумажными записками, а подружки не в курсе - странновато, нет?
  Сергей выжидающе замолчал: дескать, думай, стажер.
  - Она что-то знала о Карпентере и собиралась ему сообщить?
  - Как вариант. А еще, не забывай, она маникюрша. Тот, кто работает с биоматериалом, всегда подвергается искушению, если клиент - влиятельный человек.
  - Думаете, она могла нарушить закон о генетической тайне? Такая девочка?
  - Думаю, это нельзя считать невозможным, - серьезно сказал Сергей. - Я встречал девочек, которые еще и не то могли.
  - А Карпентер узнал и... Но у него нет предков-средиземноморцев.
  - Не найдены. - Сергей скривился, будто кофе был слишком горьким. - А узнать точно мы не можем, потому что мы (три непонятных слова) закон не нарушаем.
  - Слушайте, Сергей, а зачем этот закон? Нет, я помню формулировку - приватность генетической информации, право на неразглашение... Но чего конкретно они боятся? Что ужасного может произойти, если кто-то расшифрует чью-то ДНК? Я читал, в начале века взятие ДНК на анализ было рутинной процедурой, чуть ли не при любом задержании...
  - Чего боятся, - Сергей отхлебнул из чашки, снова поморщился, заел сэндвичем. - О, это тебе лучше расскажет эксперт Брук. Мартин, садись к нам. Скажи стажеру, почему я не могу положить перед тобой геномы подозреваемых. Зачем этот закон, спрашивает. И почему его не было в двадцатом веке.
  - Сначала последний вопрос: потому что тогда читали не весь геном, а только характерные индивидуальные участки, часто даже некодирующие. Да и это было дорогое удовольствие, и для успеха требовались микрограммы ДНК. Теперь у нас есть "сиквенс одной молекулы", цена реактивов сравнима со стоимостью кофе, которое выпивает средний детектив в течение месяца, а будешь пинаться - отсяду... Раз - и получили весь геном в виде файла, и лежат у тебя на рабочем столе геномы мистеров А, Б. и С. Читай, наслаждайся.
  - В чем наслаждение, объясни.
  - Очень просто. Нет такой базы данных, даже полицейской, которая не могла бы утечь в плохие руки. А дальше... Во-первых, можно фальсифицировать биоматериалы: уничтожить в них исходную ДНК, подмешать синтезированную ДНК другого человека и подставить его по полной: доказать этот фокус очень непросто, если делать с умом. Во-вторых, если ума и денег еще побольше... знаешь процесс Хевэн против Тафина? Что, и ты не знаешь? Рассказываю. Девушка подала в суд на известного теннисиста, заявила, что он отец ее сына. Сделали определение отцовства - точно, он, случайное совпадение было бы возможным, если бы население Земли было раз этак в сто побольше. А теннисист уперся: знать не знаю эту особу, вообще никогда ее не видел, не только в реальной жизни, но даже в Сети. И под детектором лжи это повторил, и под томографией. Пустяки, говорит девица, просто он был в тот момент неадекватен... Что оказалось на самом деле? Экстракорпоральное оплодотворение искусственным спермием. Девица имела доступ к генным базам спортсменов, украла геном, синтезировала хромосомы, а остальное в наше время - дело техники. Предприятие дорогостоящее, но окупилось с лихвой. Теннисист увидел ребенка, растрогался... Мать не посадили, потому что закона о приватности генетической информации тогда еще не было, а обратной силы он не имеет. Между прочим, этому мальчику, синтетическому сыну Тафина, сейчас должно быть лет четырнадцать. Любопытно бы узнать, как он поживает.
  - Играет в теннис или занимается биотехнологиями?
  - Ты злой человек, Сергей. Если же денег совсем мало, а сделать гадость человеку хочется, то, в-третьих, можно просто вЫчитать в его ДНК много интересной информации и распорядиться ей, как подскажет фантазия. В общем, парень, не дай Боже твоему геному попасть в руки врага. Про предрасположенность к болезням и медицинскую страховку не буду говорить, сам поймешь. Или представь себе: человек сидит в Полинезии и рассуждает о недопустимости экспансии европейцев на острова Тихого океана, а ты смотришь его геном, видишь маркеры европейского происхождения и всем об этом рассказываешь - смешно получается. Или, например, ген латентной педофилии... Хотя, конечно, про преступные генотипы - полное вранье. Современный Ломброзо.
  - Нет, почему? - засомневался Фред. - Как единственное доказательство, конечно, не пройдет, но в сумме с другими...
  - Офицер, поверьте эксперту: все это брехня желтой прессы. Нет таких генов.
  - Ну а как же статистические данные?
  - Статистические данные? - Мартин радостно улыбнулся. - Разумеется! Еще сто лет назад было известно, что половину населения Земли составляют носители варианта генома, с которым вероятность попасть за решетку в шестнадцать раз выше, чем без него.
  - Что, серьезно? - спросил Сергей. - А я почему не знаю?
  - Ты знаешь. Про этот вариант генома все знают.
  Сергей наморщил лоб.
  - Эта, как ее... моноаминооксидаза?
  - Нет. Игрек-хромосома. Мужчины попадают под арест в шестнадцать раз чаще женщин.
  - Смешно.
  - Поучительно. Многие верят в "гены преступности" и статистику вроде этой. А когда многие верят во что-то, оно становится истиной и руководством к действию, что бы там ни говорили яйцеголовые. Отсюда закон о ДНК-приватности, отсюда же паника и скандалы.
  - Тоже верно. Нормальное, черт подери, поведение современного человека. Каждый умник, чей геном едва ли заинтересует даже специалиста по лягушкам, всюду расхаживает в перчатках, целуется через кондом...
  - Сергей, Сергей, - предостерегающе сказал Мартин. - Я думаю, общество просто еще не вполне готово принять "сиквенс одной молекулы". Высокий уровень технологий плюс низкий средний уровень образования...
  - Знаешь что? Если изобретения должны появляться тогда, когда исчезнут дураки, тогда ни одно изобретение не появляется вовремя.
  - Нет, почему? Возьмем, например, открытие пенициллина. Или мобильный телефон...
  - Слушайте, - подал голос Фред, - но тогда у Герхарта тоже может быть мотив? Если он носитель гена предрасположенности к какой-нибудь болезни и боится попасть под сокращение... То-то он в перчатках ходит!
  - Резонно. Геном лучше не засвечивать перед работодателем. Конечно, уволят не за ген, найдут за что. Если ваша девочка неосторожно пошутила, что кому-то продаст его биоматериал, а человека и без того эта тема волнует...
  - Ладно, доктор философии. Ты чем-нибудь еще можешь нам помочь?
  - Могу посмотреть тщательней ту же игрек-хромосому из нашей пробы. По англосаксонским этническим группам есть хорошие данные. И по Европе, и по белой Америке. Повезет, дам процентов восемьдесят пять, что это Карпентер или Герхарт.
  - А остальные пятнадцать?
  - Остальные пятнадцать на Джузеппе Мауро, - вздохнул эксперт. - Если у него был хоть один английский предок по мужской линии, причем сколь угодно давно...
  - Тогда в чем смысл?
  - Но ты ведь говорил, что Карпентер отпадает, не нашли вы у него южноевропейских предков?
  - Не нашли. Но если бы... Слушай, посмотри все же игрек-хромосому и дай мне наиболее вероятное происхождение нашего героя по мужской линии. Фред, а к тебе будет еще просьба. У тебя в характеристике сказано, что ты занял второе место на чемпионате по сетевому поиску среди курсантов, так? Ну, вот тебе быстрый допуск в архивы англоязычной блогосферы. Мне нужны сведения - неформальные - о маме, бабушках и прабабушках Карпентера. А именно: точно ли официальные папы-дедушки во всех случаях были биологическими отцами? А я пока проверю телохранителя Карпентера. Коды кодами, но если он мог выйти из салона, а другого человека впустить...
  - Но тогда постороннего мог впустить любой клиент, - сказал Фред. Сергей поглядел на него, выдохнул сквозь зубы и ответил:
  - Будет надо - проверим и эту версию. Не любой клиент, однако ж, имеет вооруженных телохранителей.
  
  
  16:40
  - Шеф, есть! Ох и ничего себе, вы не поверите!
  - Рассказывай.
  - Я стал проверять женские линии в родословной Карпентера, как вы сказали. С матерью и отцом все чисто: обсуждение беременности в форумах, счастливый будущий папа везде фигурирует... если это инсценировка, то оч-чень продуманная. А вот мать Карпентера у своей матери была первым ребенком из трех. И родилась до ее официального замужества. Бывает, конечно, но повод для вопроса появился. Я начал рыть форумы и блоги за год до рождения. Что выяснил: бабушка мало писала о парнях, зато активно тусовалась в международном фэн-клубе Ги Нуайе, это такой актер, довольно известный. Вот, смотрите!
  - "С Днем Рождения Нашего Самого Прекрасного. Марика Томпсон". Хм, ну и что? - Сергей скептически глянул на самодельный коллаж: полненькая девица щека к щеке с известным актером начала века. - От фанатства дети не заводятся. Во всяком случае, у девочек с такой внешностью.
  - Не заводятся, факт. А теперь еще новость. Нуайе участвовал в программе "Подари мне дитя"! Знаете, что это была за программа?
  - Генетический материал от знаменитых доноров?
  - Точно. Чтобы не пострадали интересы законных родственников, мамы-фанатки подписывали отказ от всех претензий, имени - короче, права на героя принадлежат кинокомпании, а моя дочка - простая американская девочка...
  - Все, понял. Доказательства у тебя есть? Или так, гипотеза?
  - Есть чертовски офигительные доказательства, шеф! Геном Нуайе лежит на сайте Human Genome Diversity, там не свободный доступ, но Мартина как сотрудника Института здравоохранения впустили.
  - Ну? Давай говори, медаль уже твоя.
  - Сравнение с нашим материалом подтверждает близкое родство. Говоря простым языком, Нуайе легко может быть родным дедом того типа, чья ДНК была на капсуле с орхидейкой. Выводы делайте сами!
  - Ги Нуайе, "Оскар" за гомоэротическую драму, обвинен в хранении наркотиков и распространении детской порнографии, покончил с собой в 2036 году, - скороговоркой пробормотал Сергей. - Добро, порядок и семейные ценности?.. Три раза "нет" и потом "да"...
  И замер - только пальцы постукивают по подлокотникам кресла. Потом вскочил.
  - Хей, Фред! Случалось тебе арестовывать без пяти минут мэра?
  - Так это он убил Джорджину?
  - Что ты сам мне только что сказал?
  - Но почему? То есть почему он не мог...
  - Офицер, не будь таким медленным! Поехали, сам у него спросишь.
  
  
  17:10
  - Говорите, у вас есть пять минут.
  - Мистер Карпентер, зачем вы убили Джорджину Риан? Почему не обратились в полицию, когда узнали, что она хочет сделать? А если уж решили разбираться сами - временный паралич, потеря сознания вас не устроили бы?
  - На каком основании вы делаете подобные заявления?
  - На месте преступления найден биоматериал. Его анализ позволил определить набор фенотипических данных, которые однозначно указывают на вас.
  - Биоматериал... Вот сучка, так у нее было два контейнера?!
  - Не понимаю, о чем вы говорите, - безмятежно ответил Сергей, - я имел в виду след на том предмете, которым бросила в вас убитая. Что за контейнеры?
  - Я отказываюсь говорить. И то, что я сказал, вы не сможете использовать против меня. А ДНК... знаете, меня ничуть не удивляет, что вы нашли мою ДНК в салоне, где я стригся.
  - Что ж, давайте я сам расскажу. Девушка решила крупно рискнуть и подзаработать. Вы сейчас в таком положении, когда даже обрезок вашего ногтя может стать оружием в руках врага. Забавно, будто вернулись времена вуду. Эстон Браун из "Пасифика" сглазил бы вас в высшей степени качественно - мы обнаружили его контакты с покойной. Догадывался ли он, кто был вашим биологическим дедом, - интересный вопрос. Мой стажер сумел это выяснить. Правда, у нас непростые допуски, но ведь и журналисты - ребята, полные сюрпризов. А возможно, он стрелял наугад: если взять геном любого человека, в нем найдется что-нибудь способное заинтересовать публику. Не ген предрасположенности к ранней идиотии, так ген латентной педофилии...
  В дверь просунулась голова.
  - Мистер Карпентер, нас ждут.
  - Я не еду. Передайте, что состояние моего здоровья... что у меня сердечный приступ. Всего наилучшего.
  Взглянув на его спокойное лицо, Фред поразился очевидному сходству с Нуайе. Тот же высокий, слегка вогнутый лоб, те же нос и подбородок, та же улыбка... и тот же скорбный излом бровей, что в финальных кадрах "Еще одной любви". Куда мы раньше смотрели?! Тут никакой экспертизы не надо. Или это теперь так кажется, когда я знаю?..
  - Вернемся к основному вопросу, мистер Карпентер: зачем вы ее убили?
  - Я не хотел ее убивать. Меня от нее тошнило, это правда. Милая девочка, шутила со мной, благодарила за чаевые, и так хладнокровно собиралась меня предать. Мне прислал сообщение начальник нашей службы охраны... у нас есть "крот" в штабе демократов, и он доложил, что три дня назад они провели переговоры с частным генэкспертом. Нам всем рекомендовали быть осторожнее с биоматериалами - одноразовую посуду, салфетки бросать только в утилизатор, волосы не оставлять на расческе, все в этом роде. А она пять минут назад закончила работать с моими руками. Кожу срезала, шлифовала... конечно, я знал, что ей полагается уничтожать все это, но особенно не следил, все-таки солидное заведение, с лицензией... я едва не потерял сознание. Я понял, что это ловушка. Почему? Тот человек из пресс-центра - вы угадали, его зовут Эстон - сто раз мне повторил, как важно выглядеть идеально, порекомендовал этот салон, дал визитную карточку - не салона, а личную карточку маникюрши, посоветовал записаться именно к ней. И она, когда я вошел, вытащила вифон и что-то отправила...
  - Вам надо было немедленно звонить в полицию.
  - Я никому не мог это доверить. Будь проклята моя бабка с ее девичьими фантазиями - моего полного генома нет даже в медицинской карте, я подписал отказ по религиозным убеждениям. Нет, я не мог вмешивать посторонних, но убивать ее я не хотел. Должно быть, я что-то не так сделал с этим нейропистолетом. Я поднял руку, она завизжала и бросила мне в лицо этой штукой. Я выстрелил... он же срабатывает бесшумно, мне показалось, что не подействовало, я нажал несколько раз... Клянусь честью, я не хотел убить.
  - Сначала, еще до того, как все ушли, вы активировали у нее "датчик ошибок"?
  - Да. Я прицелился ей в голову, когда она проходила через холл, включил нужную частоту - прочитал в инструкции. Мне нужно было, чтобы она задержалась. Невроз навязчивых состояний, так, кажется, это называется?
  - Верно. Активируется маленький участок мозга, и человек не может уйти из дома, ему кажется, что он оставил включенную плиту, сушилку для маникюра, открытый флакон... С этим у вас все получилось, а вот с параличом допустили ошибку.
  Убийца наклонил голову, соглашаясь. Потом поднялся из-за стола и прямо взглянул в лицо детективу.
  - Что ж, я готов отвечать по закону. Спасибо вам, мистер Островски. И вашему стажеру. Я как-то устал за последнее время.
  
  
  18:16
  - Теперь таблоиды напишут, что в Карпентере проснулись гены его порочного деда, - сказал Сергей. Он сидел, опустив глаза, и сосредоточенно возил пальцем по столешнице - играл в примитивный эмулятор тенниса. - То-то будет визгу.
  - Мартин говорил, что генов преступности нет, - задумчиво произнес Фред. - Но вот как хотите... ведь Карпентер стал преступником, факт есть факт. И актер он талантливый, даже компьютер купился.
  - Карпентер стал преступником потому, что верил в гены преступности. То есть верил, что в них верят его избиратели. Я простой полицейский, я не знаю насчет генов. Но то, что человека может сделать преступником его убежденность - это наверняка... - Сергей упустил мячик и хлопнул ладонью по столу, закрывая окно с игрушкой. - Кстати, Нуайе не был убийцей, у него были совсем другие проблемы. Ладно, пойдем писать бумажки.
  - Шеф, а как насчет Брауна? Контейнера нет, Риан мертва, против него только показания Карпентера. Сможет он выкрутиться?
  - Не-ет, - протянул Сергей. - Скажи мне, Фред, ты у нас молодой и умный, новостные ленты читаешь. Кто главный конкурент "Пасифика"?
  - М-м... "Севент вэйв"? У них аудитории пересекаются, а спонсоры разные.
  - Вот и отлично. Позвони им и скажи, что есть эксклюзивная информация по поводу убийства в салоне красоты. Пока неофициальная.
  
  
  
  Луна родилась из мысли
  
  - Ты не можешь ходить, как нормальные люди? - брюзгливо спросил шеф.
  - Прошу прощения, сэр, - почтительно отозвался Сергей. - Здесь очень здорово.
  - Все чокнутые альпиноиды здесь становятся вдвое ненормальней. Одна шестая "же" сносит им крышу. Так и лез двадцать метров по отвесной скале?
  - Да, сэр. - Офицер службы безопасности "Lunar Institute for Cosmobiology and Bioinformatics" Сергей Островски подошел к столику, стаскивая с рук перчатки-"гекконы". - Оттуда чудесный вид.
  - Можно подумать, с фуникулера он менее чудесный. Садись, заказывай. Но если будешь брать спиртное, вниз поедем вместе.
  - Советуете взять спиртное?
  - Советую. Сегодня у тебя последний спокойный день.
  - Все так плохо?
  - Именно так.
  - Тогда мне рюмку бренди и два горячих тоста.
  - Бери.
  Сергей попытался угадать, что за пакость приготовил начальник, отчего не стал говорить по вифону, не вызвал к себе, а пригласил в "Горную Луну" за оплаченный столик. Пилюля, которую так стараются подсластить, должна быть редкостно мерзкой на вкус... Но меркнущее "небо" было бледно-лиловым, словно астра (в целом похоже на земной вечер), на открытой площадке ресторана в каменных вазах цвели какие-то всамделишные земные цветы, и думать о грустном совершенно не хотелось.
  Лучший и единственный ресторан базы Сэнгер располагался в скальном массиве у края кратера. Вся база как на ладони (если ладонь согнуть ковшиком). По пологому склону ярусами спускаются институтские и жилые корпуса, окруженные древесными кронами. Справа - зеленый рубчик грядок, светящиеся кристаллы теплиц. И в дальнем секторе, у "горизонта", разделенного надвое вертикальной чертой Центральных Столбов, мигает разноцветными огнями, кипит бессонной механической активностью промышленная зона.
  Полковник Картер тоже взял бренди. Отсалютовал рюмкой в ответ, скептически глянул на веселую физиономию сотрудника. Нет тридцати, долговязый, худой, черные волосы связаны на затылке в хвост. Успел облазить все скалы и все строения выше одного этажа под Куполом, подал заявку на скафандровую экскурсию... С экскурсией придется повременить, парень.
  - Ты думаешь, что так и отработаешь свой контракт, расследуя пьяные инциденты и в свободное время... - Шеф перебрал руками в воздухе перед собой, показывая, как бегают "лунные гекконы". - ...Гуляя по потолкам?
  - Нет, сэр. - Сергей выложил руки без перчаток на стол и преданно уставился на начальника.
  - Правильно. В институте чрезвычайная ситуация. В одном из компьютеров обнаружены следы взлома. Чрезвычайно умелого взлома, который к тому же имел место не вчера, а три недели назад.
  Сергей молча округлил глаза.
  - Хорошо: поздно обнаружены. Нашу систему безопасности... жестоко обидели, скажем так. Взять оттуда могли только одно...
  Шеф замолчал, пододвинул к себе интерактивную карту вин, повозил по ней пальцем, но ничего заказывать не стал. А затянувшись электронной сигаретой, вдруг сказал:
  - Ненавижу работать с этими соавторами Господа Бога. Все равно что пасти... нет, даже не кошек, а стаю павлинов. Хвастливые сукины дети, эти исследователи генных связей, или как оно называется. Ведут себя так, будто все люди братья, а научные проекты in silico - забавная игра. Нормальный, вменяемый человек, открыв нечто подобное, первым делом позаботится о безопасности - казалось бы, так? Нет, мы будем орать об этом на семинаре, и в спортзале, и в пятницу за пивом...
  - Шеф?
  - Да, ты прав. К делу. Скопирован проект вектора (шеф заглянул в блокнот) - искусственной генетической конструкции, способной к трансфекции в клетки человека и кодирующей высокоэффективные регуляторы генов...
  Сергей испуганно поднял руки вверх:
  - Извините, сэр, можно попроще, для минимального проходного балла? Что делает эта штука? Что-то смертельное?
  - Эта штука повышает интеллект, - мрачно произнес шеф. - Необратимо, наследуемо и очень сильно. Если модели верны - а они клянутся, что верны.
  - Ага, - на физиономии Сергея изобразилось облегчение, и шеф тут же спросил:
  - Чему ты обрадовался?
  - Ну, все-таки неопасная вещь. Конечно, это прокол, но могло быть хуже...
  - Болван, - беззлобно сказал Картер. - Из-за таких неопасных вещей Институт находится на Луне, а не на одиноком островке в Тихом океане. Из-за них мы с тобой тут сидим. Еще раз, медленно, для минимального балла: эта штука повышает умственные способности ОЧЕНЬ сильно. Носитель вектора настолько умнее нас с тобой, насколько ты умнее шимпанзе или трехлетнего ребенка. По сути, он уже не человек, а нечто другое. И это наследуется. Ты понимаешь, что это значит?
  - Я думаю, наверное...
  - Не понимаешь. Ну вот тебе один из сценариев. Если мы его упустим на Землю и вектор начнет распространяться - а едва ли похититель поставит свою добычу на полку в качестве сувенира! - то земляне разделятся на два биологических вида. Более умный и более глупый. Конечно, умников будет значительно меньше, но ведь и хомо сапиенсов когда-то было меньше, чем неандертальцев. Что может быть дальше, объяснять, или сам видишь варианты?
  - Нет, сэр. То есть да, вижу варианты, сэр, и ни один мне не нравится, можно не объяснять.
  - Вот и хорошо. Теперь ты мне рассказывай. Злоумышленник похитил файл с нуклеотидной последовательностью. Его дальнейшие действия?
  Сергей подергал себя за хвост на затылке.
  - Ну, он не сможет ее никому переслать, верно? Компьютерные сети Сэнгера не имеют выходов во Вселенскую Паутину. Почта с Земли принимается раз в сутки, через административный канал. Обратная связь - только голосовая... последовательность длинная?
  - Длинная, тысячи "букв", причем более половины участков не имеют аналогов, поскольку она кодирует новый белок. Криптография исключена, в голосовом сообщении это не спрятать.
  - Ага. Вообще-то он мог воспользоваться каналом дирекции...
  - Ну ладно, ты нас не смешивай с дерьмом. Не мог.
  - Если он сам не из совета директоров.
  - Тогда в заговоре все члены совета. Мы работаем и над этим, но лично я не верю в такую возможность, сейчас поймешь почему. Думай дальше.
  - Он может спрятать носитель и дождаться отпуска на Землю.
  - И что потом? Сотрудники Института покидают базу так же, как приезжают, - сирыми и нагими, только с деньгами на счету. Ничего кроме идентификатора личности. Даже белье под скафандр им выдают на транспортном корабле. Еще идеи?.. Подсказываю: ничего кроме собственного тела.
  - То есть он может проглотить носитель или, э-э...
  Шеф только глянул в ответ, и Сергей умолк. Сканер и в земном аэропорту так просто не обмануть. Ну, а если носитель будет не электронным, а каким-нибудь органическим... И тут он понял.
  - Вы хотите сказать, что он мог синтезировать вектор и ввести его себе? Чтобы на Земле, допустим, выделить? Или владеть единолично, передавая только собственным детям?
  Шеф кивнул и снова включил сигарету.
  - Второй вариант был бы большой удачей. Да, скорее всего, именно это он и сделал. Ни в какой другой форме переправить информацию нельзя. Признаю, мы недодумали про ДНК, но, видишь ли, до сих пор генетические объекты информационной безопасности никто не хотел попробовать на себе... И это плавно подводит нас к особым приметам. Похититель сейчас очень умен. Нечеловечески. Заведомо превосходит по IQ любого из нас.
  - Счастлив это слышать, сэр. Кстати, а тестирование интеллекта сотрудников нам не поможет?
  - Ты меня разочаровываешь. Я уже упоминал, что он очень умен? - достаточно, чтобы занизить результаты, будь уверен.
  - А генетический анализ?
  - Обманывать генетические тесты научились еще в двадцатом веке - сразу же, как только их начали использовать в большом спорте. И вместе с методами анализа совершенствуются методы обмана. А мы, так уж совпало, находимся в том самом месте, где собрано все необходимое и для тонкого анализа, и для фальсификации. Кровь на анализ наши службы регулярно берут у всего персонала в любом случае, просто из соображений биобезопасности: сотрудник может заразиться какой-нибудь дрянью случайно. Наш Умник об этом знает, следовательно, не мог не подготовиться. К тому же эксперт говорит, что в клетках крови трансфекция проходит медленнее и не полностью, то есть на третьей-четвертой неделе велика вероятность ложноотрицательных результатов. Продолжай.
  Сергей прищурился на скальную гряду, незаметно вздохнул.
  - В Институте две сотни человек, технический персонал исключаем. Космобиологов - ботаников, зоологов, микробиологов - можем исключить?
  - Можем. Во-первых, они слишком заняты самочувствием жаб и тритонов при лунной гравитации, с молекулярщиками и компьютерщиками общаются мало. Во-вторых, что более важно, почти никто из них не обладает необходимыми умениями и допусками.
  - Значит, остается меньше сотни. Причем этот человек должен быть умелым хакером и в то же время иметь навыки лабораторной работы и допуск к приборам. И должен уметь работать с приборами в одиночку. Уметь достаточно хорошо, чтобы потом стереть протоколы синтеза - а это тоже, как я понимаю, нетривиальная задача. Кстати, а как этот вектор попадает в организм?
  - Простая инъекция. Тут как раз особой квалификации не нужно. А почему ты говоришь об одном человеке? Как насчет сообщников?
  - Маловероятно. Заранее спланировать похищение открытия, которого, если я правильно понял, никто вообще не ожидал... А сколачивать группу прямо здесь, среди всех мер безопасности и психологического контроля, мог только самоубийца. Как говорят немцы, что знают двое, знает свинья. Скорее похититель сам и компьютерщик, и "мокрый" биолог. Есть тут такие?
  - Молодец. Но проблема в том, что тут много таких. Деньги, которые платят здесь, дуракам не достаются. И знать о векторе могли многие. Однако если иметь в виду тот уровень хакинга, который нам показали, и близкое знакомство с лабораторными приборами - годится только одна группа, из "Селена Джиномикс". Руководитель - Кэтрин Хиггс, область научных интересов - метилирование ДНК, что бы это ни значило. Сотрудники - Эрвин Баумгертнер, Йозеф Радл, Аруна Амритрай. У каждого - высшее IT-образование, все владеют навыками лабораторной работы, все время от времени синтезируют ДНК, причем сами вводят протоколы.
  - Их только четверо?
  - Рано обрадовался. Ты их еще не видел. Впрочем, завтра у тебя будет возможность. Действовать будем тихо и незаметно, минимум вовлечения непричастных. Напомни, сколько баллов ты набрал на тестах по биобезопасности?
  
  ***
  - Но в этом помещении никто не работает с биоматериалами, - холодно сказала Кэтрин Хиггс. Сергей с первого взгляда принял ее за мужчину - рыжие волосы зализаны назад, бледное вытянутое лицо, высокий рост. И голос слишком резкий для женщины, скорее похожий на фальцет. Одевались сотрудники института примерно одинаково, в блузы и брюки.
  Сергей, в таком же костюме, с бэджем сотрудника службы биобезопасности на кармашке, виновато улыбнулся и развел руками: мол, я скромный служащий, законов и правил не придумываю и дело мое маленькое.
  - Я постараюсь не мешать вашей работе, доктор Хиггс. Предупредите меня сразу, куда не соваться, и я не буду.
  - Суйтесь куда хотите, нам тут скрывать нечего, - ответил вместо начальницы темноволосый мужчина округлого телосложения, с эспаньолкой и усами. - Но на кнопки не нажимайте, иначе я не гарантирую...
  - Эрвин?
  - Да, мэм?.. А, понял. Я просто хотел пошутить.
  Остальные двое молча разглядывали его. Йозеф Радл - рослый, плечистый, коротко подстриженная борода, волосы светло-русые - спокойно встретил взгляд Сергея и вернулся к работе. Аруна Амритрай... ух ты, а я думал, Аруна - мужское имя. Невысокая, тонкие черты лица, на вид совсем девочка. Черно-шелковая коса, толщиной в Сергеево запястье, переброшена на плечо, блуза персикового цвета очень идет к ее смуглой коже, глаза ярко поблескивают сквозь густые ресницы... Ладно, сыщик, не отвлекайся.
  
  
  Вручную брать пробы ДНК на месте происшествия Сергея учили в академии. Чтобы обеспечить прикрытие на несколько суток, они с шефом придумали особый рабочий протокол, обширный и бессмысленный. Впрочем, не более бессмысленный, чем многие реальные процедуры, положенные по регламенту.
  Сергей установил "фонарь" на штативе, включил его и направил на стену. Откалибровал так, чтобы алые лазерные линии разделили серую стену на квадратики ровно по десять сантиметров каждый. Достал стерильные впитывающие тампоны, штативы с заранее пронумерованными пробирками и принялся за дело. Мазок внутри квадрата - открыть крышечку - тампон в пробирку - закрыть... и так десять раз, пятнадцать, двадцать и далее, пока не кончатся расходные материалы. Будь я настоящим лаборантом, я бы, наверное, парился, что пропущу квадрат или перепутаю нумерацию.
  Ученые между собой не разговаривали. Шелест пальцев по клавишам, хмыканье, смешок, краткое допустимое в обществе проклятие... Сергей полез на стремянку, чтобы снять пробы из верхних квадратов - мало ли, вдруг коварные молекулы поднялись с током воздуха... Оттуда ему были видны тач-скрины на столах перед каждым. У Хиггс, Эрвина и Аруны окна были похожие: какой-то график с пиками и провалами, вроде бы у всех троих один и тот же, схематическое изображение хромосомы, переливающееся цветами радуги, таблица с умопомрачающими аббревиатурами и цифрами, а также чат. Общались они виртуально. То ли им проще нажимать клавиши, чем открывать рот, то ли по контракту положено фиксировать в текстовом файле все полезные и бесполезные соображения. Йозеф Радл работал в какой-то статистической программе, Сергею незнакомой.
  Что и говорить, наблюдение за их повседневной рабочей деятельностью даст мне чрезвычайно много информации. Я могу проторчать в этой комнате месяц и даже не пойму, чем они заняты.
  Часы на стене тихонько пискнули и подмигнули. Одиннадцать часов, время кофе-брейка. Наконец-то.
  - Майкл, вы идете? - это Эрвин. (Согласно тому же бэджу, имя сотрудника службы биобезопасности было Майкл Коэн.)
  - Спасибо, с удовольствием.
  Сергей поставил пробирку в штатив, придавил пальцем крышечку, встал - и встретился взглядом с Кэтрин Хиггс. Руководительница группы смотрела на него внимательно, без улыбки, и сразу же опустила глаза.
  Кофе с крекерами пили в уютном холле, под широкими листьями лунной сенполии. Листья нависали над столами подобно зонтикам, - бледно-зеленые с пурпурными хрящами, похожие на огромные щетинистые уши. Сергей считал гигантскую фиалку омерзительной, а ее использование в интерьерном дизайне - пустой тратой органики. Однако его хорошая знакомая из ботанического сектора от таких слов приходила в негодование и принималась рассказывать, как чудесно она цветет и сколько дает кислорода.
  Белые чашечки с толстыми стенками казались чересчур вместительными, но они были меньше внутри, чем снаружи. Похоже, донца утяжелены металлом - обычная фарфоровая чашка весила бы здесь чуть больше пластикового стаканчика. Кофе переливался в чашке лениво, как горячая смола. Он был вкусный, может быть, даже натуральный, но все равно вонял. Запахи еды и напитков на Луне отличались от земных. Сам кофе пах горелым, холодными углями, залитыми водой, а тонкие имбирные крекеры - почему-то лакрицей. Лучше бы их пекли вовсе без пряностей.
  Ученые негромко переговаривались. Сергей, деликатно присев за отдельный столик, сначала пытался вслушиваться, потом перестал.
  "А почему ты решил, что твоя метилтрансфераза узнает цитозин только в этом контексте? - Мы имеем дело с тканеспецифическими паттернами, а ты пытаешься делать обобщения вселенского уровня... - Если хотите знать мое мнение, мы теперь дальше от святого грааля теоретической биологии, чем во времена Ламарка: опыты in vivo перенесены in silico, но эмпиризм никуда не делся!"
  Последнюю реплику произнес нежный голосок девочки по имени Аруна. Сергей прикрыл глаза. "Сэр, пожалуйста, не могли бы вы повторить задание? Мне, выпускнику полицейской академии, предлагается выбрать самого умного среди этих четырех людей?!"
  Ладно, что толку ныть, работать надо. Глупо пытаться... но не пытаться еще глупее. Сергей открыл заранее выбранный сайт, повернулся и спросил:
  - Извините, никто не знает, чему равна сумма всех целых чисел от одного до девяноста девяти?
  - Это что у вас?
  - Игрушка. Математический марафон. Меня приятель подсадил, у него на Земле сын в колледже, будущий гений.
  - Э-э... Элементарно, приятель, - раздался самодовольный баритон Эрвина. - Один плюс девяносто девять - сто, два плюс девяносто восемь - сто... вы следите за ходом моей мысли?
  - Слежу... - Сергей на мгновение "задумался". - А-а! То есть это получается...
  - Пять тысяч, - пискнула Аруна.
  - И не пять тысяч, дитя мое, - Эрвин ехидно ухмыльнулся девочке, та покраснела. - Намекаю: сколько всего слагаемых?
  - Девяносто девять, - с готовностью ответил Сергей. - То есть это выходит сорок девять пар по сто и плюс... э-э...
  На этот раз правильный ответ дала сама доктор Хиггс. Через пять минут все четверо ученых, отодвинув чашечки и раскрыв на столиках экраны, решали задачи марафона. Сергей привстал со своего места, якобы от азарта, наблюдая и сопоставляя.
  Доктор Хиггс работала с ледяным неподвижным лицом, лишь иногда проводя рукой по волосам. Именно работала - непохоже было, что она развлекается. Пальцы пробежались по клавиатуре - и снова полная неподвижность. Эрвин вздыхал, ерошил волосы, дергал себя за усы и бородку, азартно скалил зубы, когда находил решение; по его мимике можно было определить, как далеко он продвинулся, и не глядя на экран. Йозеф забавно выпячивал нижнюю губу, размышляя; лицо его было спокойным, он даже зевнул один раз. Аруна хмурилась, как школьница на трудной контрольной. Она и сидела, по-детски скрестив щиколотки под стулом.
  Первой прошла марафон Кэтрин Хиггс. Эрвин обиженно взвыл и удвоил видимые усилия. Он был вторым, но Аруна отстала секунд на пять. Последним оказался Йозеф Радл.
  Даже лучший результат и по времени, и по набранным очкам был много ниже рекордного, зарегистрированного в институтской сети. Зато даже худший был выше результата Майкла Коэна, он же детектив Островски.
  
  
  После кофе-брейка все вернулись к работе. Сергей - тоже. Наблюдать он уже не пытался. Надо было придумать, что делать дальше.
  Без паники, приказал он себе. Я умнее шимпанзе. Пожалуй, умнее ребенка. Но значит ли это, что мне легко обмануть того или другого?
  Сергей вспомнил, как пытался помешать своему трехлетнему племяннику съесть шоколадную конфету, запрещенную его матерью. Джонни сначала купился, увидев пустую вазочку, потом заметил, что дядя держит руку за спиной... Так, стало быть, на чем я погорел? На том, что недооценил сообразительность и наблюдательность этого клопа. Мало дела имею с детьми, подумал, что он не заметит или не догадается. Годовалый ребенок не догадался бы, верно?..
  Ага. Значит, я неверно оценивал его интеллект, иногда считал его умнее, а иногда глупее, чем он был на самом деле. И что это мне дает? Мой фигурант совсем недавно был таким же глупым, как я... ладно, и тогда был умнее, неважно. Он помнит, как мыслил тогда и как мыслят другие люди? Да, но я ведь тоже когда-то был трехлетним и злился, когда взрослые врали мне и делали честные лица... и читать не умел, точно помню, как бабушка со мной сидела и показывала буквы. Но не помню, почему это было трудно - учиться читать. Когда мы умнеем, нам трудно представить себе мышление глупого. Даже самого себя в прошлом. Так, что ли?
  Допустим, что так. Допустим, что мой фигурант плохо представляет себе, что знают и чего не знают другие люди. Что они могут и чего не могут. Тогда что он сделает, чтобы не выделяться? Выяснит, сколько времени уходит у среднего человека на решение той или иной задачи... проверить бы их обращения к базе данных... нереально: много времени прошло, но попрошу шефа. Не интересовался ли кто-нибудь из них ай-кью, возможностями человеческого мозга или другими подобными задачами. Да нет, ерунда. Не может он или она узнать и запомнить, сколько надо тормозить и как ошибаться для всех возможных случаев. Ладно бы стандартные тесты... В нестандартных ситуациях он смотрит на остальных, на их реакцию и старается не выделяться... Они не видели, что делают другие участники, но видели, кто первым закончил. Первой была Хиггс, последним - Радл... Значит ли это, что он притворялся тупым, или ему попросту было неинтересно? Хиггс могла стремиться показать лучший результат, потому что она начальница... Вообще, если подумать, самые подозрительные - немец с маленькой индианкой: средний результат самый безопасный. Кажется, я в тупике.
  А если зайти с другой стороны? Эрвин очень быстро отщелкал последнюю серию задач. Сразу после того, как закончила руководительница группы. Как будто бы он понял, что больше можно не осторожничать.
  
  ***
  
  В конце рабочего дня все сотрудники института отправлялись на тренажеры. Никто специально не следил за соблюдением режима, но никто и не пренебрегал тренировками - охота была отправиться на Землю по причине устойчивого снижения мышечной массы, силы сердечных сокращений или изменений в структуре костной ткани. Врачи в Сэнгере были большим начальством: того, кто попадет у них в немилость, не спасет ни администрация, ни научный руководитель.
  Сергей направился в тот же зал, что Эрвин и Йозеф. Чех покосился на него, подняв бровь, но смолчал. Впереди прошуршала дверь, в коридор вышли три женщины из соседней группы - тоже, по-видимому, на тренировки. Эрвин причмокнул им вслед и подмигнул Сергею, как старому знакомому.
  - Какие - а? Особенно та, что слева, брюнетка, - он описал руками расходящиеся дуги. - Зовут Марго.
  Сергей понимающе усмехнулся.
  - А у вас в биобезопасности девочек много?
  - Почти половина сотрудников.
  - О-о? И как они, в смысле?..
  - Вполне биобезопасно, - с серьезным видом ответил Сергей. Эрвин хохотнул и тут же принялся рассуждать о том, как влияет малая гравитация на психологию и физиологию, в особенности мужскую, и какими упражнениями необходимо дополнить обязательные комплексы, и что именно следует держать в тонусе в первую очередь... Похоже, Баумгертнер не был любителем женщин. Он был профессионалом. Поддерживать беседу оказалось несложным: кивай и ухмыляйся. Йозеф не принимал участия в разговоре - брезговал или просто не интересовался.
  А неплохой ход для Умника - играть сексуально озабоченного болтуна. Убедительно играет: вон как глазки блестят. Сергей вспомнил когда-то читанное - будто большинство гениев было секс-гигантами. Ерунда, городской миф, но объяснялось довольно логично, что-то насчет тотального превосходства высокого интеллекта, его склонности доминировать и влияния на гормоны... Все равно не верю, что это пошлое трепло - Умник. Но ведь в этом и состоит его замысел, разве нет?..
  Автомат в раздевалке выдал одноразовый фитнес-костюм. Теплая после печати ткань была странного сероватого цвета, видимо, окраска сбоила. Эрвин уже разделся и придирчиво тыкал в кнопки другого автомата. Объемистое волосатое бедро охватывала татуированная женская подвязка. Черно-красная, кружевная, с бантиками и витиеватой подписью - "Honi soit qui mal y pense". Да будет стыдно тому, кто подумает дурно. Так вот ты какой, гипертрофированный интеллект... впрочем, ерунда: татуировка, конечно, сделана еще на Земле.
  Наверное, каждый второй мужчина Базы хотя бы раз просил друзей снять на видео себя-любимого под штангой. Пускай внушительные стопки "блинов" в шесть раз легче, чем на Земле, от земных представлений о весе металла трудно избавиться: смотришь на хлипкого лысеющего постдока и видишь, что он бьет рекорд по тяжелой атлетике. Сергей даже в первые дни сниматься не хотел: при его телосложении картинка получилась бы скорее комической, чем героической. А уж когда каждый день выжимаешь проклятую штангу, то приседая и вставая с ней в страховочной раме, то лежа, от груди - желание позировать проходит окончательно.
  Во время разминки Эрвин умолк, но на беговой дорожке через несколько минут опять принялся за свое.
  - И почему мы с девчонками занимаемся отдельно? Убил бы того, кто это выдумал. Одно дело эта дурацкая кофта, другое - майка. И потом, сколько было бы новых возможностей! Знакомиться в столовой - не мой стиль. "Горная Луна" хороша для того, чтобы сводить туда свою женщину, но искать там новую - без шансов. Вы не бывали в "Горной Луне", Майк?.. А, ну тогда вы все знаете. Дамы предпочитают посещать такие места со спонсором, свободных там почти не бывает. А вот в корпусе зоологии в верхнем этаже симпатичный бар, называется "Си-элеганс". Молодежный, правда - и по ценам, и по меню, но туда же не есть ходят. Музыкальная программа, акробатические танцы, лоу-грэв... Я там встретил одну девушку. Что-то необыкновенное: талия - вот (Эрвин отпустил поручни и свел большие и указательные пальцы, показывая малую окружность), зато нижние измерения оччень объемные, и представляете - вдруг делает сальто и идет на руках! Такое духоподъемное зрелище... В "Си-элеганс" вы тоже бывали, Майк?
  - Не случалось, спасибо за информацию. Но я не понимаю, Эрвин, зачем вам ходить так далеко?
  - Мне? О, я предпочитаю не охотиться там, где живу, - Эрвин сошел с дорожки, вытер порозовевшее лицо. - Путать работу и любовь... нет, у меня есть принципы. К тому же, понимаете, это не лучший способ строить отношения в группе, когда женщина - босс.
  Йозеф, все это время молчавший, усмехнулся. Или показалось?
  - Я имел в виду, неужели в вашем корпусе нет таких заведений? - невинным тоном спросил Сергей.
  - Представьте себе, нет. - Эрвин тяжело вздохнул, примерился взглядом к скамье для жима лежа. - Это же не от щедрот проекта, это частная инициатива. Наши девочки развлекаются в Сети. Они у нас забавницы, одна, например, послала директору отдела по связям с общественностью свою фотографию топлесс - не слышали эту историю? У-у, это было здорово. Но по мне, в реале интересней... А вы куда ходите по вечерам?
  - Я занимаюсь мундерингом, - честно сказал Сергей: правда ничем ему не грозила.- Лунным скалолазанием. Неплохое хобби, лучше земного болдеринга. И девушкам нравится.
  - О, вот как? Должно быть, очень увлекательно, - Эрвин лег на скамью, взялся за гриф штанги, страдальчески заломив брови.
  - Очень, - ответил Сергей и направился к своей штанге. Солидной мышечной массой он и на Земле похвастаться не мог, и здесь программа-тренер постоянно начисляла ему добавочные нагрузки.
  ...Хорошо, а если создать ситуацию, когда у Умника не будет возможности притвориться глупым? Или что-то, что перевесит необходимость притворяться. Что-нибудь связанное с опасностью для жизни... Метеоритная тревога, ага, прекрасная идея. Помимо того, что подобное следственное мероприятие едва ли можно назвать незаметным, все двести сотрудников отреагируют одинаково: побегут к аварийным выходам, к лифтам в подземные этажи. Умник, возможно, не побежит, а пойдет, зато по оптимальному маршруту? Но маршруты, рекомендованные на занятиях по технике безопасности, - наверняка и есть оптимальные, их придумывали не гении, зато потрудились как следует... Нет, нужно что-то принципиально иное.
  
  ***
  
  Картер закрыл отчет детектива, неодобрительно покрутил головой и направился в его кабинет.
  Островски развязал узел на затылке, пряди волос свисали ему на щеки. Перед ним на столе были разложены рядами блокнотные листки, исчерканные распечатки плана Сэнгера. Сергей отодвинул бумажки, спутав ряды, и уставился на тач-скрин. Поставил пальцем несколько точек, соединил их ломаной линией. Стер линию, переставил точки. Подумал и начал обводить точки кружками. На появление начальства Островски не отреагировал.
  - Принести тебе зубочисток?
  - М-м?
  - Я видел фильм, где русский шпион у нацистов выкладывает фигуры из зубочисток. Это помогало ему думать.
  - Из спичек, - рассеянно произнес Сергей.
  - Что?
  - Спички это были, сэр. Деревянные палочки с горючей смесью на кончике. Вместо зажигалок. Производили их в огромных количествах. У каждого мужчины была в кармане коробка спичек.
  - Откуда ты все знаешь, Островски, - проворчал шеф. - И как они загорались, если зажигалок не было? Сами по себе?
  - Не сами. Ими чиркали, вот так, - Сергей ударил сложенными пальцами правой руки по ладони левой. - Это трение...
  Он замолчал, уставившись на Картера неподвижным диким взглядом. Затем повторил шепотом: "Это трение", стер точки с экрана и расставил их заново.
  - Я начинаю жалеть, что поручил тебе это дело, - задумчиво произнес шеф. - Задачки для вундеркиндов разрушают твой мозг. И говоря откровенно, мне не кажется, что от этого будет прок.
  Островски взглянул на шефа так, как будто увидел его впервые, и медленно улыбнулся.
  - Дайте мне еще сутки, сэр. Послезавтра я назову вам Умника. Степени свободы, вот что мне нужно.
  - Ну ты и наглец, - тон Картера был скорее удивленным, чем возмущенным. - Как будто я ограничиваю твою чертову свободу. Но имей в виду: два дня, не больше.
  Ответа не последовало, если не считать невнятного звука, похожего на "угу". Картер махнул рукой и вышел.
  
  ***
  
  Назавтра вместо тренировок они сажали деревья. Гениальная идея психологов: сотрудникам базы якобы необходимо контактировать с земной флорой хотя бы раз в две недели, во избежание депривации, депрессии и кто их знает чего еще. Уму непостижимо: как без этого обходятся жители земных мегаполисов, которые контактируют с образчиками флоры, только заказывая салат к бифштексу?
  Смесь реголита и органического субстрата, о происхождении которого лучше не думать, имитировала земную почву. По мнению Сергея, слишком хорошо имитировала. Она была грязной, если называть вещи своими именами. Счастье, что психологи не заставляют развозить эту субстанцию вручную, в тачках, ради еще более тесного контакта с землей. Новый участок почвенного слоя создали машины, саженцы лунного тополя привез транспортер-автомат, другой автомат сделал ровные ряды ямок. Майклу Коэну и Йозефу Радлу (Эрвин предъявил психологам медицинское заключение о растяжении спинных мышц) досталась несложная задача: один держит саженец, опустив корни в ямку, другой с помощью лопаты засыпает в нее грунт.
  Тополь. Кора на стволиках сероватая и прохладная. Веточки как тонкие пальцы с опухшими суставами, острые коготки почек, облитые коричневым клеем... Хотелось сорвать одну, ощутить клей на пальцах, вдохнуть запах. Наверное, это было можно - и разве не для этого психологи все затевали? - но рука почему-то не поднималась. Все равно что оторвать "на память" кусочек пленки от солнечной батареи.
  Шагах в двадцати черный земляной ковер истончался, уходил вниз, будто прибрежный песок к воде. Дальше начинался лунный пейзаж. Впрочем, лишившись резких лунных теней, реголит и камни смотрелись удивительно заурядно, совсем по-земному. Вроде шахтных отвалов.
  - Все это совершенно неверно, - сказал Йозеф. - Опустите пониже... да, так, спасибо. Все это неверно, я говорю. Чем старательнее мы строим вокруг себя декорации, тем сильнее будет шок, когда иллюзия прекратится.
  - А она прекратится?
  - Она обрывается каждую минуту. Посмотрите на небо.
  Небо, коричневато-золотистое, равномерно светящееся, с "востока" уже наливалось фиолетовым. Фотоэлементы Купола во время лунных дней накапливали солнечную энергию, а отдавали ее в режиме земных суток - восемь часов света, четырнадцать часов темноты и по часу на "сумерки". Избыток расходовался на обеспечение фотосинтеза.
  Свет как на Земле сквозь густое марево - мягкий, ровный, бестеневой и чем-то страшный. Будто находишься внутри средневековой картины, и вот-вот из-за скалы вылезет дракон святого Георгия.
  - Да, на Земле такого не увидишь. Давайте лопату, теперь моя очередь... А я Купол видел близко.
  - В самом деле? Вы и там контролировали биобезопасность?
  - Нет, я увлекаюсь скалолазанием. Если подняться примерно на километр, на нем можно разглядеть "соты". Такие темные шестиугольники по светлому фону.
  - Там проложены какие-то кабели?
  - Кабели, трубы. Эффект очень странный: понимаешь, что небом это быть не может, но и потолком тоже - слишком далеко. Невозможно поверить глазам, сам себе внушаешь, что эта сетка - обман зрения. Вроде оптической иллюзии - знаете, белые пятна в черных перекрестьях и все такое. Хочется проморгаться, чтобы эта сетка исчезла.
  - Интересно, - протянул Йозеф. Похоже, ему действительно стало интересно - в первый раз за все время знакомства с сотрудником службы биобезопасности Коэном.
  - Так, по-вашему, нам не следует устраивать здесь подобие Земли?
  - Я думаю, не следует. Лучше бы нам иметь мужество и не скрывать от самих себя, что мы живем внутри воздушного пузыря, и только стенка его отделяет нас от космоса. Нам нужно осознать правду.
  - Осознать, что мы живем в воздушном пузырьке в сотнях тысяч километрах от Земли? А разве не вредно фиксироваться на таких мыслях?
  - Психологи считают, что вредно. Но по мне, это неполное подобие Земли с тем же успехом может свести с ума. Не сразу заметно, но рано или поздно сработает. Вот зачем нужны эти деревья, да еще в таком количестве? Разве у нас избыток углерода, чтобы тратить его на производство целлюлозы?
  - Деревья дают кислород, ботаники все время об этом говорят...
  - Фотоэлементы Купола прекрасно справляются с кислородным обеспечением. А если вдруг их мощности станет не хватать, проще покрыть крыши "искусственными листьями", в светлое время они дадут приличную прибавку.
  - Ну, по мнению тех же психологов, деревья нам необходимы. Как часть нашей естественной среды.
  - А по моему мнению, это вздор. Бедуины тысячелетиями жили в пустыне. Дело привычки, элемент культуры. Надо привыкать к мысли, что мы находимся в искусственной среде. Отчасти искусственной, отчасти виртуальной. Все ее элементы, привычные нам, созданы органическим синтезом и информационными технологиями, и ничего в этом нет страшного. Нас же не пугают полилактатные тарелки вместо фарфора и текстовые файлы вместо пергаментных свитков.
  - Вы не слишком строги к людям?
  - Нет, - Йозеф оглянулся и нажал на кнопку маленького пульта, подманивая "лейку". - Я же не предлагаю изменить, скажем, состав пищи. Или длительность светового дня - это серьезно, это встроено в нас и на генном уровне, и на физиологическом. Чтобы от этого избавиться, слишком многое пришлось бы менять.
  Последнее было сказано равнодушным тоном, будто речь шла о перепланировке офиса. Очевидно, невозможным это не представлялось.
  - Йозеф, но если использовать ваш метод аналогий, в земных больших городах суточное освещение тоже ненормальное - днем смог, ночью подсветка. А люди живут.
  - А кто вам сказал, что в больших городах у людей все в порядке с физическим и психическим здоровьем?
  - Один-ноль! - Сергей засмеялся. - Но уж, наверное, в этом виноват не цвет неба.
  Бесшумно подъехала "лейка". Йозеф рассеянно погладил хобот, изливавший точно отмеренную порцию воды в рыхлый грунт у стволика.
  - Вы удивитесь, но и цвет неба в том числе. - Йозеф говорил так, будто диктовал главу собственной книги - больше заботясь о безупречном построении фразы, чем об эмоциональном контакте с собеседником. - Нарушения естественного светового режима влияют на многое, вплоть до интимных процессов генной регулировки. В том числе и тех процессов, которые ведут к раковому перерождению клетки, это как раз наша тема.
  - А я слышал, что вы занимаетесь метилированием ДНК.
  - Метилирование - это механизм регулировки. Один из механизмов. Обратимые химические изменения ДНК без изменения последовательности. Интересно то, для чего они используются. На определенных участках сперва недостаток метильных групп, затем избыток... ну неважно. Не знаю, в курсе ли вы, но рак и старение - две стороны одной медали.
  - Да, школьная учительница нам рассказывала. (Это "не знаю, в курсе ли вы" прозвучало крайне оскорбительно.) Неконтролируемое деление клеток - это рак, исчерпание потенциала обновления - старость.
  - Старость. И добавим, что частота раковых заболеваний с возрастом увеличивается - косвенное указание на то, что это поломки в одном и том же механизме. Ну как... то ли вентиль приржавел и не поворачивается, то ли сорвался с резьбы. Но это один и тот же вентиль.
  Оставалось еще два деревца. Лиловая тень, похожая на грозовой фронт, перевалила через зенит, и в самом деле начал накрапывать дождик. Лунный дождик, мельчайшая морось, ни капель, ни струй - оседающий конденсат. Наше дыхание на стекле, за которым Космос.
  - Значит, вы решаете великую задачу? Победа над раком или бессмертие? Или то и другое сразу?
  Йозеф даже не усмехнулся, только приподнял брови, но Сергей почувствовал, что краснеет. Если у чеха и была сверхчеловеческая способность, так это талант превращать собеседника в идиота.
  - Мой учитель говорил: если студент хочет изобрести лекарство от рака, создать таблетки для вечной жизни или еще как-то осчастливить человечество - проку от юноши или девушки не будет, это гуманитарный подход. Но если студент хочет найти ответы на вопросы "как это устроено" и "что оно делает" - возможно, это наш человек.
  - Немного цинично, нет?
  - Нет. На самом деле это имеет отношение к способу думать.
  - Так вы вчетвером хотите узнать, "как это устроено"?
  - Отчего бы нет? (Если Йозеф и обиделся, виду не подал.) Бывает достаточно и одного. Мысль рождается в одной голове.
  - Зачем же вы тогда объединяетесь в группы? Мне раньше всегда представлялось, что умственную работу должны выполнять одиночки. Как, не знаю, философы или великие физики...
  - Мы объединяемся в группы затем, что в естественных науках философии предшествует сбор материала. Анализ информации, заложенной в геноме, в своем роде не менее трудоемок, чем сбор ботанических коллекций. Мы сейчас - как натуралисты прошлых веков, если вам угодно. Своего рода экспедиция Линнея или Гумбольдта. Только экзотические страны, по которым мы путешествуем, - это геномы. В экспедиции не ходят в одиночку.
  - И кто же ваш Гумбольдт? Доктор Хиггс?
  - Вы имеете в виду, кто руководит нашей экспедицией? Разумеется, доктор Хиггс. Она принимает решения, в какую сторону нам двигаться.
  Йозеф помолчал и добавил:
  - А капитаном корабля "Бигль", на котором путешествовал Чарльз Дарвин, был некто Роберт Фицрой.
  - И чем знаменит этот Фицрой?
  - Не помню. Мало кто помнит, я полагаю. Кажется, был вспыльчив.
  - Вы хотите сказать, что...
  - Я просто привел исторический факт.
  Сергей промолчал. Надменный интеллектуал с комплексом превосходства - идеальная маска для Умника? Что хочешь надежно спрятать, прячь на виду. В хороших детективах убийцей никогда не бывает неуравновешенный тип, ревновавший девушку к покойному...
  - Я лишь хотел сказать, что в нашей группе каждый выполняет свою роль и каждый, следовательно, незаменим. На данном этапе не может быть иначе. Когда тот же Гумбольдт и Бонплан путешествовали в Америку, работы хватило обоим. И славы тоже.
  - Я понял вашу мысль, - вежливо сказал Сергей. Йозеф усмехнулся в бороду - то ли примирительно, то ли высокомерно.
  
  ***
  
  - Что хочет пан офицер?
  Зося была прелестна. Звезда ботанического сектора, богиня лунных цветов, Диана и Флора в одном лице. Русые волосы - как патина на серебре, темные глаза, тонкие брови. Я бы согласился быть лунной сенполией, только бы ты улыбалась при виде меня и заботилась обо мне... Впрочем, Сергею Островски и так грех было жаловаться. Среди биообъектов, не принадлежащих к царству растений, его явно отличали.
  - Пан офицер хочет повеситься. - Он отшвырнул перчатки, рухнул в кресло, локти поставил на столик и лбом уперся в ладони. - Мешает пану офицеру одна лишь низкая гравитация.
  Зося рассмеялась и ушла за стеллаж. Дверца отъехала в сторону, звякнуло стекло.
  - Сказал бы "и прелесть шановной пани", но недолго мне осталось любоваться этой прелестью. Не сегодня-завтра меня попрут отсюда с жирным минусом в личном деле. И первым транспортом на Землю.
  Скажем честно: пока я ничего не знаю. Ведь кроме Эрвина и Йозефа, есть еще начальственная Кэтрин и кроткая Аруна. Пока у меня нет оснований предпочесть кого-то одного. Никаких оснований.
  - Что ты натворил? - Зося возникла вновь, неся две маленькие мензурки, заполненные коричневой жидкостью.
  - Не справился с заданием. Эти деятели слишком умны для меня. Мне нужен один из них, и я не могу его выловить никаким законным способом.
  - А незаконным? - Она схватывала на лету.
  - Незаконным... тоже не могу. Я и так, и так прикидывал. Если бы у меня было четыре руки, и на всех "гекконы"... иначе получается не просто превышение полномочий, а уголовщина.
  - Четыре руки? - Зося положила на столешницу свои белые ручки. Почти рядом с Сергеевыми.
  - Зося! - решительно, с возмущением сказал Сергей. - Нет, я не могу даже просить тебя об этом.
  - Так не проси, - коротко ответила она. - Просто расскажи, что мы будем делать.
  
  ***
  
  Традиционные институтские вечеринки с пивом по пятницам, в общем, не отличались от земных. Разве что не было видно дряхлых гениев в электрокреслах и бестолковых младшекурсников, но те и другие и на Земле не составляют большинства. В большом кафе зажгли дополнительные лампы (оставив, однако, неосвещенными уютные углы), вместо классической музыки включили Диану Дум, по залу расставили столики с закусками, а на стойку взгромоздили бочонки с напитками. Кроме напитков безалкогольных, имелось лунное пиво - плотное, крепкое и почти без газа. На вкус Сергея, редкостная гадость, но ученым вроде бы нравилось.
  По традиции тут веселились только научники. Но наивный Майкл Коэн, едва дождавшись упоминания о пятничном сборище, простодушно спросил: "А можно и мне прийти?", и поскольку его не послали прямым текстом, - пришел. Держаться старался в тени, не привлекая лишнего внимания: мало ли, вдруг объявится знакомый да разлетится к нему с радостным "хай, Серж!"
  У дальней стены зала почему-то поставили обыкновенный одежный автомат. Рядом собралось с дюжину девиц и дам. Сергей узнал Аруну - она стояла спиной, но второй такой черной косы не было нигде в Сэнгере. Другая девица, с фиолетовыми волосами, что-то набирала на выдвижной клавиатуре, остальные ей подсказывали. На экранчике виднелись строчки программы, судя по реакции зрительниц - ужасно смешные.
  - А сюда квадратичную функцию!
  - Лучше третью степень!
  - Хи-хи-хи!
  - Что они делают? - спросил Сергей. Эрвин ухмыльнулся, передал ему бокал с пивом и двинулся к девицам крадущейся походкой злодея. Подкрался, вытянул шею, и тут же фиолетовая обернулась и завизжала. Визг подхватили остальные, кто-то закрыл экран ладошками, кто-то возмущенно замахал на Эрвина, отгоняя его, как муху:
  - Герр Баумгертнер! Вам не стыдно?
  - Эрвин, уйди сейчас же!
  - Нарушение приватности!
  Эрвин отступил, миролюбиво поднимая руки.
  - Что там?
  - Я не понял, - признался Эрвин, забирая пиво. - Да ладно, отсюда посмотрим, когда вытащат.
  - Что такого занятного может быть в этом ящике?
  - Это-то как раз ясно: пользовательский режим. Вопрос только в том... Ага, они ее запустили.
  На экранчике возникли песочные часы, женская стайка примолкла, и стало слышно, как в автомате работает 3D-принтер. Не прошло минуты, как лоток открылся, и фиолетовая девица подхватила и подняла перед собой в пальчиках... девы победно заверещали и зааплодировали, Эрвин поперхнулся пивом. Изделие, фиолетовое, в тон прическе, было выполнено в режиме жесткой экономии высокотехнологичной полилактатной ткани. Немного там той ткани, прямо скажем.
  - И стоило беспокоиться о приватности, чтобы потом ими размахивать? - тихо произнес Сергей. - Но как они это сделали? Я и не знал, что там есть программа на... э-э...
  - Танга-трусики, - докончил Эрвин. - Конечно, нет. Но они же сами программеры. Взломали автоматик, перенастроили. В нем нет графического редактора лекал, так они вручную задают кривые. Умницы. Бросить бы эту интеллектуальную мощь на научные цели... хотя тогда жизнь стала бы скучной.
  Любительница фиолетового тем временем отступила в задние ряды, запихивая изделие в карман брюк. У клавиатуры толкались две следующих пользовательницы - на вид совсем девчонки.
  - Теперь я!
  - Нет, я! Слушай, я уже тебе уступала в прошлый раз! Я хочу такие же, как у Бет, я только цвет заменю и распечатаю!
  - Эф-эф-ноль-ноль-эф-эф?
  - Да ну тебя! Я хочу синий морской, Алина, пожалуйста, подожди одну минутку...
  - Женщины как дети, - снисходительно заметил Эрвин. - Талантливые, но дети. С твоего позволения... - он встал и снова направился к девицам. Подошел к Бет, что-то шепнул ей на ушко. Бет захихикала и пихнула его в плечо.
  Сергей снова оглядел зал. А ведь и в самом деле, как он раньше не замечал? Предполагалось, что все сотрудники Института носят стандартную одежду, которую выдают вот такие автоматы. Нижнее белье, блузы простейшего кроя, брюки, в качестве переменных параметров - женская или мужская модель, рост, размер, пять базовых цветов, для каждого шесть градаций насыщенности, для блузы - желаемая длина рукава. Цвета создавались за счет поверхностной наноструктуры. Эластичная ткань из биополимера не подлежала стирке, ношеная одежда шла на переработку в биореакторы.
  Однако то, что носили в свободное время сотрудники и особенно сотрудницы отделения биоинформатики, явно не ограничивалось упомянутыми параметрами. Хорошо, с трусами более или менее понятно, но где они берут платья? Вот это зеленое мини, или вон то, с разрезами по бокам... Должно быть, перепрограммируют блузу.
  А Йозеф и здесь сидел в том же серо-голубом лабораторном костюме. Сосал электронную трубку, прихлебывал кофе.
  - Как вам местное пиво, Майк?
  - Ну... Вы говорили вчера про попытки имитировать Землю.
  - Да, попытка провальная.
  - Вы сами его не пьете?
  - Я родился в Праге, - с чувством сказал Йозеф, - для меня это - не пиво.
  Пожалуй, то была самая эмоциональная фраза, какую Сергей от него слышал.
  - Космические пивные дрожжи его делают, - продолжал Йозеф. - Их вывели специально для невесомости, знаете? Нечувствительны к перепадам гравитации, живут на солодовом концентрате, сделанном из фотосинтетической глюкозы. Дают высокий процент алкоголя и мало углекислого газа. Прекрасно, только кто сказал, что продукт жизнедеятельности этих грибков можно называть пивом? Хотел бы я посмотреть в глаза тем экспертам...
  Сергей как раз примеривался отхлебнуть из бокала, но при упоминании "продукта жизнедеятельности грибков" поставил его на стол.
  - Да, если бы оно по крайней мере было с газом...
  - То оно бы вспенивалось по объему в момент наливания, - докончил Йозеф обреченным тоном учителя младших классов для альтернативно одаренных детей. - Здесь архимедова сила в шесть раз меньше, пена плохо всплывает. Знаете историю про орбитальный сатуратор?
  - Нет.
  - Нет? - Йозеф довольно запыхтел трубкой. - Я вам расскажу. Это было, когда готовили первую большую орбитальную научную экспедицию. Я тогда только окончил университет, мне повезло, что взяли. Сам я там не был, но говорю со слов очевидца. Приходят в штаб представители одной крупной компании - производителя газированных напитков, я намеренно ее не называю. И говорят: мы выступаем в качестве спонсоров, а вы берете на борт наше оборудование, чтобы научная элита могла наслаждаться нашей продукцией прямо на орбите. Вы сошли с ума, говорит им Эдвардс, ваша газировка в невесомости изойдет пеной в момент открывания. Они сияют и машут ручками: эту проблему мы решили, технология запатентована, испытана в экспедициях NASA, просим пять минут вашего внимания. И разворачивают презентацию циклопического сооружения по имени "орбитальный сатуратор". Там много чего было: цилиндр с поршнями и эластичными стенками, с цифровым управлением, для смешивания воды и сиропа с газом при оптимальном давлении, какая-то хитрая система дозаторов и клапанов, чтобы разливать газировку по "грушам". А из "груши", как вы понимаете, ей деться уже некуда, неси ко рту и пей.
  Йозеф еще несколько раз затянулся.
  - Ну вот, свернули они презентацию, улыбаются во все зубы: мол, как, договорились? Все молчат - вроде нет причин возражать, да и денег они принесли много. И тут Петров, он был ядовитый такой: господа, будьте любезны пояснить, как вы модифицировали последний этап? Они к нему: да-да, конечно, у вас есть вопросы по дозатору и разливатору? Нет, говорит, не по дозатору. На самом деле я имел в виду потребителя, то есть ученого-астронавта. Вы, конечно, знаете, что происходит в желудке с сильногазированной водой в условиях невесомости и какими ощущениями это сопровождается. Есть идеи по этому поводу?..
  - Отлично! - Сергей расхохотался, в общем, не особенно притворяясь, благо и лунное пиво было крепким. - А как же деньги?
  - Деньги они дали. Автомат взяли на орбиту, переналадили так, чтобы газа было еле-еле, как в этом... (Йозеф указал на бокал Сергея.) Он, правда, сломался в первую же неделю, но логотип по прямой связи был виден, а больше ничего от нас и не требовали.
  Рассказав байку, Йозеф с очевидностью утратил интерес к собеседнику, и Сергей почел за лучшее ретироваться. К тому же он заметил, что Аруна отошла от девичьей компании и присела к столику с закусками. Ее туника, кстати говоря, даже не была однотонной: у ворота нежный персиковый цвет, чем ниже, тем ярче, к подолу сгущается в мандариновый. Стало быть, одежный автомат можно заставить сделать и такое.
  - Устали ждать? - спросил он. Аруна сейчас же вспыхнула как маков цвет.
  - Нет, я не хотела себе ничего делать, я просто смотрела.
  - У вас очень красивая туника. Ваша собственная программа?
  - Да, но мне Бет немного помогала.
  Сергею еще не случалось разговаривать с ней подолгу. Кажется, обычная девушка из ученой среды, насмешливая и застенчивая. (Если забыть о том, что Умником может быть и она.) Социального опыта еще меньше, чем у ее сверстниц, работающих в супермаркете, плюс уровень интеллекта, достаточный для Сэнгера... Ну ладно. В эмпиризме теоретической биологии ты, Островски, не разбираешься, но светская болтовня на общие темы тебе вполне по силам, и на сайт по индийской культуре ты только что заглядывал. Избегать пошлого заигрывания а-ля Баумгертнер, держаться серьезно и уважительно. Вперед!
  - Знаете, Аруна (можно по имени?.. спасибо)... Знаете, у меня странное ощущение. Йозеф мне объяснял, что здесь у нас виртуальный мир. Понимаете, о чем я, - запрограммированная одежда, синтезированная еда, компьютерная музыка, экраны с пейзажами вместо окон. Я хотел спросить вас, не это ли философия индуизма называет "майя"?
  - Не совсем, - девушка усмехнулась. - Майя - это вся материальная жизнь. По сравнению с непреходящей истиной мысль, информация не более призрачна, чем то, что называют материальным. Я не очень хорошо разбираюсь в философии. Но я представляю, что вам рассказывал Йозеф, это его любимая тема. Он еще все время говорит, что луна - символ такого... невозможного или нездешнего.
  - Да, пожалуй. "Достать луну с неба", "свалился с луны". У вас тоже есть такие поговорки?
  - У нас говорят: "Что луне до воя собаки?" - Аруна улыбнулась шире, блеснув белыми зубами.
  - В индуизме ведь Луна - это божество?
  - Да, его зовут Чандра. - Она рассеянно загребла из мисочки полную горсть мелких разноцветных кубиков фруктового сахара и принялась отправлять в рот один за другим.
  - Ах да, была же знаменитая орбитальная обсерватория "Чандра", верно?
  - Да, только ее назвали не в честь бога, а в честь астрофизика Субрахманьяна Чандрасекара. Нобелевский лауреат, знаете? Предел Чандрасекара.
  - В самом деле? Фамилия от имени божества - по-моему, очень поэтично.
  - Но это не фамилия, - кротко сказала Аруна. - У него было личное имя, Чандрасекар, и патроним, имя отца, фамилии не было совсем.
  - Как интересно, - промямлил Сергей, не решаясь спросить, почему с нобелевским лауреатом такое приключилось. Островски - король интеллектуальных тусовок.
  Аруна поедала конфетки, ехидно косясь на него. Смуглая кисть руки казалась покрытой загаром (чего, конечно, в Сэнгере быть не могло). В центре зала тем временем освобождали место, двигали столики. Длинноволосый парень настраивал стрингборд. Звуки пока что не радовали слух: будто кто-то дергал железными когтями проволочную сетку.
  - Кстати о нобелевских лауреатах, Аруна. Вы можете бросить в меня камнем и назвать средневековым сексистом, но я смотрю на это множество женщин и девушек, и мне как-то... тревожно, не поймите неправильно. Ведь все-таки это внеземная база, высокий уровень риска. В марсианские экспедиции женщин не берут - и правильно делают, только не сердитесь, пожалуйста. Стоит ли этого наука? Вы не согласны со мной?
  - Как сотрудник службы биобезопасности, вы должны знать, что риск на Базе одинаков для обоих полов.
  - Так именно это мне и не нравится, - проникновенно сказал Сергей. - Я не считаю, что женщины должны рисковать так же, как мужчины. Вот вы, Аруна, - очень ли нескромно будет спросить, как вы решились заключить этот контракт? Неужели ваши родные не были против?
  - Они были против. Но я хотела не тратить время на чепуху, а сразу заняться чем-то по-настоящему интересным, вы понимаете? Здесь на собеседовании молодость считается плюсом, а не минусом, потому что важно здоровье. А на Земле ни один ученый ранга доктора Хиггс меня бы не пригласил.
  - Доктор Хиггс - действительно крупный ученый?
  - Конечно, - с легким оттенком презрения, "что-ты-в-этом-смыслишь", ответила Аруна.
  - Вам интересно работать под ее руководством?
  - Очень. Мы каждый день продвигаемся на шаг вперед.
  - Мне она показалась достаточно жестким человеком. Строгим к себе и окружающим.
  Девушка хотела что-то ответить и вдруг уставилась на Сергея. Нет, на что-то позади него. Снова просияла белозубой улыбкой и толкнула его в плечо: обернись, мол.
  На свободном пятачке стояли трое: два постдока из отделения физиологии, один лысый, другой кудрявый, и... Кэтрин Хиггс? Не может быть.
  На строгом и жестком человеке было платье шоколадного цвета, с лентой-поясом и широкой юбкой, обшитой по краям медными бусинами. Плоский офисный зачес пропал, голова Кэтрин была похожа на пламенную розу, на огненный шторм. И лицо переменилось. Нет, красавицей она не стала - никуда не делись короткий нос с раздвоенным кончиком, тонкие губы - но мужеподобным это лицо никто бы не назвал.
  Сколько же времени она тратит каждое утро, чтобы прилизать волосы? Или наоборот, сколько времени она потратила сегодня, чтобы завить их и вздыбить? Сергей обдумал все, что знал о женских прическах, и решил, что возможно и то, и другое.
  - Смотрите, смотрите! - Аруна дернула его за рукав.
  Звуки скрипки взмыли к потолку, закружились по залу - конечно, скрипка тоже не настоящая, вон кто-то таскает "бегунок" по черной коробочке, но все как следует, отчаянно лихо и чуть-чуть фальшиво. Гитара подхватила ритм, и трое в пустом круге подпрыгнули на месте.
  Сергей с удивлением услышал легкий перестук каблучков. Да, это туфельки доктора Хиггс, мужчины пляшут бесшумно. Она вытянулась в струнку, сжала руки крестом под грудью, будто мерзла - зато ноги, силы небесные...
  Не то чтобы он впервые в жизни видел ирландский танец. Видал и отлаженную машинерию шоу-дэнса, и козлиный галоп после пятой кружки, когда танцующие сшибаются ногами и налетают на столы, и робкие аккуратные подскоки учеников школы танцев. Тут было другое. Эти трое танцевали неплохо, но ясно ощущалось, - более для своего удовольствия, нежели для зрительского. И вот чего, конечно, на Земле не увидишь - чтобы танцоры буквально реяли в воздухе, еле касаясь пола. (Ну, разве, может, на зеленых холмах в лунные ночи, или где там пляшут эльфы.) Высокие прыжки в конце такта были ощутимо более долгими, и скрипка замирала на долю секунды, ожидая, пока снова цокнет каблучок, - чтобы потом закружить с новой силой. Сергей понял, что бусины на подоле платья не были простым украшением: без них слабое лунное тяготение не справилось бы с требованиями приличий.
  Я думал, ей лет сорок-пятьдесят. Ладно, тяготение пониженное, но темп... Парней возле нее просто не видно. Она что-то празднует, вдруг подумал Сергей. Ставлю месячное жалованье против чашки кофе, тут не просто любовь к танцам. Если бы она ТАК любила танцевать, сидела бы на Земле. Осанка, взгляд, поворот головы... К делу этого не подошьешь, но Кэтрин Хиггс очень счастлива.
  Скрипка вывела последний стремительный росчерк, финальные ноты заглушило аплодисментами и воплями. Коллеги обступили доктора Хиггс и повели за столик. Аруна напевала мелодию танца и хлопала в ладоши, Эрвин угодливо предлагал начальству стакан с лимонной водой, и даже на бородатой физиономии Йозефа появилась улыбка. Сергей незаметно пристроился рядом.
  - Кэтрин, а почему ты не работаешь руками, когда танцуешь? - Эрвин как бы невзначай положил свою руку на спинку стула начальницы - похоже, принципы спасовали перед привычками. - Это специально?
  - Специально. Моим предкам, - она чуть задыхалась, - священники говорили, что делать движения руками во время танцев - распутство.
  - А... э-э... делать движения ногами, вот вроде тех, что мы сейчас видели - это не распутство, по их мнению?
  - Трудно ответить. Скорее всего, этого просто не смогли запретить.
  По лицу Эрвина было видно, что данная идея сильно подействовала на его воображение.
  - Все не так плохо. Любое ограничение стимулирует...
  - Изобретательность?
  - В том числе. И создает стиль.
  Ирландский вечер продолжался, молодежь уже исполняла "Мика Магвайра" под тот же стрингборд и синтез-скрипку. Пели на нескольких языках одновременно.
  - Майкл, а вам понравилось?
  Сергей пару раз моргнул и прочистил горло.
  - Доктор Хиггс... я в восхищении. - В такие минуты говорить женщинам правду не просто надо, а необходимо, и с максимальной экспрессией.
  - Сейчас просто Кэтрин, - ответила начальник группы.
  
  - Джонни, вставай, давай вставай, чего ты там притих?
  Видишь, это Мик Магвайр, он сестры твоей жених!
  Есть у Магвайра деньги, и даже ферма есть,
  Ты весь день отдыхал, вставай, нахал, дай Мику Магвайру сесть!
  
  (Здесь и далее перевод Олега Иванова, Green Crow.)
  
  Любители ирландской культуры горланили громко и с чувством. Йозеф поднялся с места и вышел, показав рукой: мол, еще вернусь. Аруна, прихватив свой чай, снова направилась к столику со сластями, за ней пошел Эрвин с каким-то по счету бокалом пива. Уселся рядом, на взгляд Сергея - ближе, чем допустимо между просто друзьями. Коротко о чем-то спросил, уже совсем интимно приблизив губы к ушку. И где твои принципы, старый ты козел, мало того, что вы вместе работаете - она же тебе не по возрасту...
  Кэтрин наблюдала за ним, явно забавляясь. За ту секунду, что он переглядывался с ней, диспозиция изменилась. Аруна выставила перед собой руку ладошкой вперед и сделала движение, будто толкает тяжелую створку двери. Эрвин неохотно восстановил приличную дистанцию. Кэтрин рассмеялась.
  - Вы так беспокоитесь, Майкл! Для Эрвина это просто игра, что до Аруны, я не вижу причин за нее волноваться. Она умная девочка.
  - Сколько ей лет?
  - Не помню точно, - Кэтрин пожала плечами. - Двадцать четыре, может быть, двадцать пять, она только перед отлетом окончила университет. Это есть в ее личном деле.
  - Извините, я не должен был спрашивать. Но я все никак не приду в себя. Никогда не считал женщин-ученых синими чулками ("никогда - это примерно последние полчаса?"), но такого не мог и вообразить!.. Ваше здоровье.
  Он отсалютовал ей бокалом, глядя прямо в глаза и улыбаясь. Ответная улыбка была скорее скептической, но свой бокал она тоже подняла. Надо же, доктор Хиггс не разучилась краснеть под мужским взглядом.
  - Вы давно занимаетесь танцами?
  - С детства, - коротко ответила она. - Майкл, а вы, собственно, кто? Я имею в виду, служба безопасности или научный шпионаж?
  Сергей открыл рот, чтобы выразить изумление, но она остановила его презрительной гримаской.
  - При заборе проб вы сделали три ошибки в первые же пять минут. Вы никогда раньше этим не занимались. Вы такой же инспектор биобезопасности, как я Джим Уотсон. А кроме того, вы говорите teep вместо tip, у вас примерно такое же произношение, как у Йозефа. Полагаю, вы скорее Михаил Коган, чем Майкл Коэн, или же вас зовут совсем по-другому.
  
  Джонни, садись, давай садись, а то он стул займет!
  Видишь, это Мик Магвайр, он последний идиот!
  Не слушай его, Джонни, он пьяный раздолбай,
  Никуда не ходи, сынок, сиди и стул ему не давай!
  Дидигилон-дилон-дилон-дилон...
  
  Кэтрин постукивала туфелькой в такт и без улыбки смотрела ему в лицо.
  - Моя мама родилась в Москве, - не моргнув глазом ответил Сергей. - А что касается проб, я прошел инструктаж и делаю все так, как меня учили. Возможно, и неправильно, вам виднее.
  - Неправильно - это сказано очень слабо, - тихо проговорила Кэтрин. - Вы не специалист.
  - Вы рассказали об этом сотрудникам?
  - Они сами не без глаз. Но я хочу знать, что происходит на самом деле.
  - Конечно, у вас есть предположения, - с галантной улыбкой сказал Сергей. С одной стороны, сделать руководителя группы своим союзником - именно то, что ему сейчас нужно. С другой стороны, нельзя поручиться, что Умник - не она сама.
  - Ну, тот, кто явился бы выведывать наши предварительные результаты, вероятно, лучше соображал бы, - безжалостно сказала Кэтрин. - Но нужно принять во внимание, что выбор кандидатур ограничен местным контингентом - до кого дотянулись и кого смогли устроить, того и заслали. Что в пользу другой версии - в вашем внедрении явно замешана администрация. Такая наглость более характерна для наших внутренних служб.
  - Великолепно. И ваши дальнейшие действия?
  - Если вы из безопасности без приставки "био", то писать жалобы бесполезно. Но, будьте уверены, я сумею от вас избавиться, и вы, лично вы, пожалеете, что взялись за это. В чем бы вы ни подозревали моих людей, это не может быть важнее нашей работы, зарубите на носу. Если же вы заняты научным шпионажем - я буду считать инцидент исчерпанным, если вы больше не появитесь в лаборатории. Я даже не спрашиваю, кто ваш заказчик. Просто передайте ему, чтобы в другой раз лучше готовился.
  Известная нелюбовь яйцеголовых к безопасникам, желание отстоять сотрудников от малейшего нашего посягательства, нежелание уступить даже клочок своей территории. Или бравада непойманного преступника, старое доброе "я знаю, что ты знаешь, и ты знай, что я знаю"? В конце концов, Островски, можем ли мы со стопроцентной гарантией исключить сообщничество? Что если она знает о делах Умника и покровительствует этим делам? Умнику, раз уж он так умен, ничего не стоит вычислить ту, кто его не сдаст...
  Сергей развел руками.
  - Мне остается капитулировать. Даю слово, что больше не появлюсь в вашей лаборатории. А взамен маленькая просьба. Не препятствуйте мне сейчас.
  - В чем не препятствовать?
  - В планах на уикенд. Я хочу пригласить вас и ваших коллег на маленькую прогулку по окрестностям Института. Видите ли, я увлекаюсь мундерингом, лунным скалолазанием. Это довольно забавное хобби, и, по-моему, Эрвина и Йозефа мне удастся убедить. Я хочу предложить вашей группе небольшую экскурсию, к центру базы и потом - вверх. Да, я пропагандист мундеринга. Я считаю, что глупо побывать на Луне и не взять то лучшее, что она может дать.
  - Зачем это вам? Я имею в виду, приглашать нас?
  - Ну... скажем так: у меня есть и личная мотивация, Кэтрин. - Он снова посмотрел ей в глаза, надеясь, что выглядит откровенным и беззащитным. - Знаете, я и сам понимаю, что у ваших сотрудников и вас лично сложилось не слишком хорошее мнение обо мне. Вы вольны верить или не верить, но мне просто хочется... (он якобы незаметно откинулся на стуле и чуть повернул голову, чтобы взглянуть на Аруну)... чем-то порадовать вас.
  - Нас. - Кэтрин холодно усмехнулась. - Ну что ж, не вижу причин для отказа. Аруна, можно тебя на минутку?
  Аруна снова подсела к ним.
  - Мистер Коэн любезно приглашает нас на прогулку куда-то в скалы... куда именно, Майкл?
  - Не в скалы, прошу прощения, - на Столбы, - сказал Сергей. - Знаете, эти семь колонн, которые связывают Купол с подземными ярусами. Теоретически, если на вас "гекконы", по ним можно добраться до самого неба. То есть до купола. При здешнем тяготении это по силам любому, специальной подготовки не требуется.
  - Ой, а разве это разрешено?
  - Нигде не написано, что запрещено, - с лукавым видом сказал Сергей. - Мы все очень внимательно смотрели.
  - Что именно не запрещено? - поинтересовался Эрвин, подойдя сзади.
  - Подъем по Столбам с "гекконами", - ответил Сергей. Эрвин округлил глаза: что такое Столбы, ему явно не надо было объяснять. - Помните, я рассказывал про мундеринг? Я только что пригласил Кэтрин и Аруну - и вас с Йозефом, конечно, тоже - завтра присоединиться к нам. То есть ко мне и одной моей знакомой из ботанического сектора.
  - О, вы говорили, что девушки тоже этим увлекаются. А как зовут вашу знакомую?
  - Зося.
  Эрвин отодвинул стул и уселся рядом с ним.
  - Да, Майк, это был бы любопытный опыт, я вам очень признателен. Мне давно хотелось попробовать, как это делается. Хотя, конечно, и страшновато. Эти ваши "гекконы" - они надежны?
  - Абсолютно. Одна перчатка с нановорсинками держит восемьдесят лунных килограммов на любой поверхности, на ровной - до сотни. Можете висеть на одной руке без всяких усилий. Но когда поднимаешься по ровной вертикальной поверхности, в этом едва ли будет необходимость. Кстати, наклон не имеет значения, можно ползать хоть по потолку - да вы, наверное, видели, как ребята это делают.
  - А как же отрывать руку от поверхности, если они такие цепкие?
  - Движением вперед и вверх, - Сергей показал, - это просто.
  - Хм. А если все-таки повиснешь на руке? Что делать дальше?
  - Ну, обычно мы ходим группами, и у всех есть выкидные тросы со смарт-магнитами. Даже если ваш напарник бросит трос не очень точно или вы не сумеете поймать его, он сам вас найдет. Я считаю это перестраховкой, но лучше избыток безопасности, чем недостаток.
  - Убедили, - Эрвин обернулся к доктору Радлу. - Йозеф, пойдешь с нами на Столбы?
  Выслушав предложение, Йозеф поморщился.
  - Меня избавьте, я и в школе не любил этих развлечений. Спорт не мое хобби.
  - Йозеф, не будь занудой, - с улыбкой, но твердо сказала Кэтрин. - Всем нам не повредит немного развеяться. И ты же хотел сходить на край Сэнгера, посмотреть скалы и Купол. Тот путь до Купола, что предлагает Майкл, по-моему, легче.
  
  
  ***
  
  До Столбов было чуть больше километра, но чтобы не тратить сил и времени на пеший путь, Сергей через свои связи в техотделе позаимствовал летающую тележку. Сиденье в ней было одно, для водителя, и ученые с Зосей уселись на огороженной платформе, на пустых контейнерах.
  Под Куполом нечему портить покрытие, и едва ли дорожку чинили хоть раз за двадцать лет. Сергей набрал скорость, чтобы воздух бил в лицо и трепал волосы. Дорожка бежала под уклон, к центру кратера.
  Настоящий ветер вместо механической циркуляции воздуха. Настоящий холодный дождь. Брызги морской пены, снежинки на ресницах... Господи, хочу на Землю. Что бы там ни сочинял Йозеф, жить в гигантском ангаре - это для роботов, не для людей. Даже если все обойдется, не буду продлевать контракт.
  Сергей задумался, как это было двадцать лет назад. Долгой лунной ночью в маленький кратер, который тогда еще не носил имя Фредерика Сэнгера, падают кометы. Не ударяют с разлету, а именно падают, как ягоды с ложки в блюдце. Каждую из них выследил беспилотный аппарат, после экспресс-анализа вцепился ей в бок и начал подогревать с нужной стороны, регулируя газовый поток и направляя чудовищную глыбу к Луне. Тонкая, наверное, была работа, все равно что ловить кубик сухого льда в невесомости.
  А потом за считанные сутки, пока терминатор лунного дня не достиг кратера и глыбы замерзшего газа не вскипели и не улетучились, унося с собой миллионы затраченных средств, - возводится Купол. И уже под ним эти глыбы таяли, истекая туманом... или в вакууме не могло быть тумана? Наверное, под конец появился. Купол сомкнулся, исчезли черное небо и слепящий свет, в янтарном сумраке замигали фотоэлементы автоматов и "аватар". Они не нуждались ни в кислороде, ни в пище - ни в чем, кроме энергии от гелиевого реактора, укрытого в пещере под кратером. Купол, Столбы, корпуса домов и каркасы теплиц - все это построили они.
  Драгоценная вода - именно здесь, у северного полюса, ее оказалось много, но "много" по лунным меркам, не по земным - пошла вверх, по трубам Столбов. Вода плюс углекислота равняются кислороду и моносахарам, а на месте стрелки - энергия Солнца, не экранированного атмосферой, и батареи "искусственных листьев", осуществляющих реакцию фотосинтеза в условиях, которых не выдержало бы ни одно растение. С Купола в атмосферу потек кислород, а раствор в сетке из трубок, как древесный сок в гигантском листе, насытился молекулами сахара и понес этот сахар, сделанный из космического СО2, к краям Купола, в подземные хранилища.
  Тогда пришли люди. Начали расходовать кислород и выделять углекислый газ, запустили биореакторы (глюкоза глюкозой, но без аминокислот и липидов не проживешь), собрали и подключили агрегаты, изготовляющие из раствора органики плитки рациона. Потом заработали другие биореакторы, для утилизации отходов. Одноразовая посуда превращалась в обрывки целлюлозы с примесью азотсодержащих молекул, та же судьба постигала одежду. Воду жаль тратить на стирку и мытье посуды, да и органику лучше везти с Земли в форме полезных предметов. По нескольку граммов с каждого участника проекта ежедневно, и вот уже поднимаются ростки в оранжерее... Сергей вспомнил анекдот про бартерный договор между Сэнгером и новым поселком астрофизиков на обратной стороне Луны и фыркнул, отвлекаясь от возвышенных мыслей. Анекдот кончался словами: "Зато дерьма у нас много!"
  Все-таки было в этом что-то странно уютное. Как обустройство на стоянке в походе или в шалаше, в детстве. Вот здесь положим доску, это у нас будет стол, а тут будем спать. Натаскаем сена, дверь завесим эльфийским плащом, а на случай дождя накроем крышу пленкой... И в Сэнгере каждая полезная мелочь удивительно радовала душу, а неустроенность была предметом типично походных шуток. Кто его знает, может, и хорошо бы к этому привыкнуть?
  А может, и нет. В палатке только потому уютно, что из нее можно вернуться в большой комфортабельный дом.
  За спиной переговаривались.
  - Ух, а вон и Пятно! Видите, над северным горизонтом, градусов двадцать вверх?
  - О. Но это же не...
  - Да! Это след от метеорита. Того самого, семьдесят шестого года. Там прозрачность так и не восстановилась. Говорили, метра четыре в поперечнике...
  - Матерь Божья! Эрвин, какие ужасные вещи ты рассказываешь! - Сергею показалось, что Кэтрин только изображает испуг. Что-то в ней осталось от вчерашней плясуньи.
  - Ничего ужасного, док. Он же не упал никому на голову, только повредил верхние слои Купола. А сильная утечка атмосферы нам не грозила, не более, чем через шлюз. Там герметизация происходит практически мгновенно.
  - Но если бы ударил большой метеорит? - спросила Аруна. - Я имею в виду, по-настоящему большой, из тех, что создает километровые кратеры.
  - А, моя дорогая, мы уже сидим в трехкилометровом кратере! - легкомысленно ответил Эрвин. - Как это говорится - бомба не падает в воронку от бомбы?
  - На Луне падает, - это, разумеется, Йозеф. - Наш маленький кратер находится внутри большого.
  - Йозеф, не пугай девушек. Все это было давно, сотни миллионов лет назад. И вряд ли повторится при нас. А уж если большой метеорит прилетит, на крайний случай, противометеоритные службы наконец отработают свой бюджет!.. Зося, а что вы делали, когда объявили учебную тревогу, помните, в прошлом году? У нас было так весело...
  - Меня тогда еще здесь не было, - небрежно ответила Зося.
  - О, так вы недавно прибыли?
  - Недавно.
  Сергей с трудом подавил желание оглянуться: как там с дистанцией?
  - А я удивляюсь, отчего не видел вас раньше. Значит, эта радость вам еще предстоит.
  - Глупость, а не радость, - проворчала Кэтрин.
  - Не без этого. Но, знаете, в нашей ситуации есть и плюсы! - Эрвин цокнул языком, очевидно, изображая вставление кредитки в гнездо.
  - Есть и другие преимущества, - серьезно сказал Йозеф.
  - Приехали, - Сергей опустил тележку и сам соскочил на грунт, чтобы помочь сойти Кэтрин. Зосе и Аруне протянул руки Эрвин; Аруна оперлась на его руку, Зося - нет.
  Зрелище, безусловно, стоило внимания. Зона в центре кратера оставалась неосвоенной, дорога шла по чистому реголиту. Воздушные потоки наметали его на полотно, и лунные песчинки сухо поскрипывали под ногами. Но главное - Столбы.
  Их было семь: по углам шестиугольника и один в центре. Темно-серые, почти черные колонны, округлые, матово-гладкие, каждая метра полтора в диаметре, и друг от друга на расстоянии около десяти метров. Ничего особенного - если не считать того факта, что они подпирают небо.
  Семь ровных вертикалей поднимались и поднимались, истончались в вышине, таяли в янтарном утреннем свете, и нельзя было сказать, стоя у подножия, упираются ли они в Купол или просто уходят в бесконечность, опровергать либо подтверждать Эвклида.
  - Ух, - изрек Эрвин. - Какова их высота, Майк?
  - Километр двести метров, около того. Но на последних пятидесяти метрах датчики, туда лазить действительно нельзя.
  - Спасибо вам, Майк, - негромко сказал Йозеф. - Сам бы я вряд ли сюда выбрался.
  - То ли еще будет наверху! - весело ответил Сергей. - Приступим?
  Раздобыть шесть комплектов снаряжения, не привлекая ненужного интереса, было отдельной задачей, спасибо Зосе. Присев на край платформы, ученые натягивали прямо поверх легкой лунной обуви ботфорты с "гекконами" на стопах и коленях, застегивали ремешки на длинных, выше локтя, перчатках. Овальные накладки с микроворсинками на вид напоминали серую замшу, но если коснуться их голой рукой, ощущение было неожиданным: "гекконы" хватали за пальцы.
  Сергей лично показал каждому, как надевать страховочную привязь с тросом - "надеваем лямки на плечи, как куртку, закрепляем нагрудный ремень, закрепляем пояс, застегиваем набедренные лямки...". Не было времени размышлять о том, как нехорошо он поступает минимум с тремя присутствующими.
  - Я слышала, что надо закреплять страховочный трос где-нибудь наверху? - спросила Аруна. - Если человек сорвется, он на нем повиснет.
  - В данном случае это было бы сложно, - Сергей картинно запрокинул голову к вершинам Столбов. - Но у каждого из нас есть трос, про смарт-магниты я уже рассказывал. Если вдруг кто-то начнет падать, подхватим.
  Еще минут десять ушло на стреляние тросом, подвешенным к поясу на карабине, пока Сергей не убедился, что неофиты усвоили навык "прицелился примерно в сторону товарища и нажал на нужную кнопку". Эрвин попытался подтянуть к себе Зосю, и Сергей скомандовал подъем.
  Сергей и Зося уступили начинающим столбы, с которых был лучше виден жилой сектор, как наиболее живописный, но Эрвин выбрал другой, сказав, что хочет взглянуть на промзону. Тогда Сергей полез на центральный столб, а Зося - на один из двух оставшихся, рядом с Аруной. Чтобы не напрягать голос, все нацепили гарнитуры от вифонов и включили "общий разговор".
  Мундеринг - легкий вид спорта. В шесть раз легче земного болдеринга, в буквальном смысле слова. Плюс "гекконы", с которыми неважно, насколько сильные у тебя пальцы и есть ли за что ими хвататься. Сначала ты вспоминаешь, как смотрел на земные соревнования, и думаешь, что нипочем так не сможешь, потом очень стараешься, а потом лезешь вверх, насвистывая, в эйфории от собственной легкости и ловкости, ощущаешь себя Спайдерменом и не замечаешь, с какой скоростью удаляешься от земли. Медленнее, чем на лифте - но ненамного.
  Лиловая ночная тень давно скрылась, Купол понемногу светлел, коричневый янтарь становился золотым. Сергей и раньше водил новичков на Столбы и был уверен, что баек ему хватит на все отпущенное время. Сначала он давал рекомендации по движению - "чуть медленнее... ритмичнее... не надо торопиться, у нас не соревнование..." Потом начал рассказывать о Столбах, работающих и резервных. Потом - о красотах, которые можно увидеть, если чуть-чуть повернуть голову. Только бы теперь никто из них не устал, не испугался и не запросился вниз. Устанут вряд ли, получасовой подъем - ерунда после наших обычных тренировок, но если до кого-то дойдет раньше времени, что они находятся в трети километра над грунтом без всякой страховки... - "Обратите внимание, сейчас виден пруд в ботаническом секторе! Вода золотистая, ха-ха, голубой она здесь не бывает ни при какой погоде..."
  - Эрвин, - в наушнике раздался прекрасный голос Зоси, - вы не знаете, что это там такое?
  - Где, моя дорогая? - Эрвин шустро переместился вправо и исчез за колонной.
  - Вон там, промышленный сектор, среднее кольцо. Рядом с круглой полосатой штукой, такое металлическое, блестит.
  - Вон то, решетчатое? - Сергей увидел руку и колено Эрвина с другой стороны колонны. По голосу было слышно, как он выворачивает шею. - О, я думаю, это какая-то опорная конструкция... или, может быть...
  Идиотская затея. Буду считать себя счастливцем, если все обойдется травмами. Еще и Зосю втянул. Отставить панику. Ага, вот оно.
  Технические измышления Эрвина перебил Йозеф.
  - Майк, - голос его был совершенно спокойным, - мои "гекконы" меня не держат, я съезжаю вниз. Это нормально?
  - Как - съезжаете вниз? - тупо переспросил Сергей.
  - Ой! И я тоже!
  - И я!
  - Коэн, что происходит?
  - Черт побери, не знаю! - заорал он в ответ. - Вчера не было! Что-то осело из атмосферы, какой-то конденсат!
  Два из утверждений формально правдивы и одно лживо. Скольжение ускорялось медленно, как в дурном сне. Полтора метра в секунду, один и шесть, чтобы быть точным, это вам не девять и восемь. Ладно, пусть только дециметры, мы все же еще тормозим перчатками, пока микроворсинки не оторвались окончательно, но когда оторвутся, это не составит разницы... все равно что на Земле упасть с двадцатого этажа, и у меня не более десяти секунд...
  Сергей, быстро перебирая руками и коленями, начал смещаться вправо,. Только бы Кэтрин или Аруна не выстрелили по мне, они же меня рванут назад, ну что же ты, Умник, зараза...
  - Нет, стоп! Слушайте меня!
  Он не сразу понял, кто это взвизгнул так отчаянно. А потом сердце забилось реже. Как перед выстрелом, когда целишься.
  - Майк, кидайте Эрвину трос, только не натягивайте. Йозеф, немного вправо, Кэтрин - влево. Эрвин, бросайте Йозефу. Зося, вы - Майку, и двигайтесь влево.
  Теперь он ощутил спиной успокоительное прикосновение провисающей веревки. Если ее натянуть, то его прижмет к колонне... ненадолго, пока не сорвет Зосю. Скольжение ускорялось, мелкие рябины на колонне сливались в линии, будто перед глазами тащили полосатый шелк.
  - Никто не натягивает веревки! Зося, бросаю...
  - Есть!
  - Кэтрин, вы - мне... Есть. Йозеф, видите Кэтрин? Бросайте. Спокойно, у нас получилось, теперь выбираем слабину и тормозим, на счет три. Раз, два...
  Сергея прижало к колонне, он уперся в нее коленями и ладонями, и скольжение замедлилось. Сила рывка показала, какую скорость они успели набрать. Он увидел, как натягивается паутинка, связавшая Аруну и Зосю, превращаясь из дуги в наклонную прямую. Шесть точек - пять в углах шестиугольника, одна в центре - соединились серебристыми отрезками, которые плавно укорачивались. Невыпуклый многоугольник, натянутый на шести вертикалях, становился плоским.
  Он покосился на часы. Падение продолжалось сорок три секунды.
  Значит, вот таким образом. Совру, если скажу, что не ожидал. А если скажу, что давно это предчувствовал, совру тем более. Один шанс против трех, вот и все.
  В наушниках звучало множественное тяжелое дыхание, кто-то отдувался и кашлял, кто-то нервно хихикнул.
  - Уф-ф... Сколько мы пролетели? - это спросил Йозеф.
  - Метров двести.
  - Нет, меньше.
  - А сколько до грунта?
  - Еще сто.
  - Коэн, я буду вас бить! - голос Эрвина был хриплым, он снова откашлялся. - Прекрасный активный отдых, ду шайссе!
  - Бейте, - согласился Сергей. - Я сожалею. Не понимаю, что произошло, честное слово.
  - Он сожалеет... ду блёде зау! Как вы могли подвергать риску начинающих, тем более женщин?!
  - Эрвин, хватит кричать, - Кэтрин запыхалась не больше, чем после танца. - Ты согласился на это. Чем думал ты, когда соглашался?
  - Руководитель группы разрешила, - огрызнулся Эрвин. Кэтрин презрительно фыркнула.
  - С мистером Коэном, - фамилию Кэтрин ядовито подчеркнула, - я сама поговорю, когда спустимся. Аруна, а ты умница. Как это ты сообразила так быстро!
  Аруна Амритрай не отвечала. Ни начальнице, ни мужчинам, наперебой хвалившим ее спокойствие и смекалку. Сергей стиснул зубы. Стоило чуть расслабить руку или ногу, мышцы сводило дрожью.
  
  
  Эрвин не исполнил свою угрозу. Он сделал несколько шатких шагов, от колонны, потом назад, привалился к ней спиной и сполз вниз. Так и остался сидеть с нелепо задравшимся воротом. Зося важно прошла мимо, подарив его презрительным взглядом из-под ресниц. Эрвин только трепыхнулся, как бы пытаясь сделать мостик на лопатках: ноги его не держали. Сергей позавидовал ему. Повалиться наземь и закрыть глаза - сейчас было бы самое то. Он встал спиной к группе, потверже расставив ноги, вытащил вифон и отправил условное сообщение.
  Йозеф позади него заботливо спросил: "Аруна, девочка, ты в порядке? - Да, Йозеф, все хорошо, спасибо". Голос ровный и печальный. Он обернулся. Аруна медленно, один за другим расстегивала ремешки перчаток и смотрела вдаль, на дома и деревья. Прощается? Высматривает катер службы безопасности?
  - Аруна, извините меня.
  - Ничего страшного. Все хорошо.
  От этого вежливого ответа мороз продрал по коже. Это не было гордое признание поражения. Ему снисходительно простили мелкую шалость, которая, к счастью, не причинила вреда.
  - Кэтрин, как ты?.. - спрашивал между тем Йозеф. Доктор Хиггс небрежно отмахнулась и шагнула к Сергею.
  - Объяснитесь.
  Не было ни сил, ни смысла врать и ссылаться на непредвиденные обстоятельства.
  - Простите меня, Кэтрин, и спасибо вам за помощь. Это было... считайте, что это был тест.
  - Ка... какой тест?! - Йозеф даже запнулся от возмущения. Кэтрин снова отстранила его движением руки.
  - Мы могли покалечиться, мистер Коэн. Или погибнуть.
  Сергей ощутил приступ несвоевременной веселости.
  - Ох, я виноват. Как раз перед тем, как мисс Амритрай взяла командование на себя, я собирался сказать про оранжевую полоску... конечно, это следовало объяснить до восхождения, но я не мог предположить...
  - Про какую, к чертовой матери, полоску? - вопрос был задан тем же холодным тоном, только нос чуть-чуть дрогнул, как у собаки, учуявшей врага. Сергей молча поддел пальцем правой руки оранжевую полоску на запястье левой перчатки и легким движением, будто вскрывая упаковку конфет, отделил от ладони кружок испорченного "геккона". Под ним оказался второй такой же.
  Кэтрин молча повторила его действия. Подошла к столбу, приложила ладонь, дернула вниз - соединение было прочным. И снова повернулась к Сергею.
  
  
  ***
  
  - Рыжая стерва, - неразборчиво произнес Островски, прижимая к губам противоотечную салфетку. - У меня левый клык шатается.
  - Зуб не нос, вырастет новый, - флегматично отозвался шеф. - Не ной.
  - Драться она, наверное, тоже училась в пабах...
  - Я хорошо понимаю доктора Хиггс, - сказал Картер. - Ты выполнил задачу, но кто бы знал, как хочется добавить тебе еще и в глаз... Хватит страдать, у нас есть о чем поговорить.
  Сергей послушно выбросил салфетку в корзину и сел прямо. Что-то ему подсказывало, что разговор будет не только о заслуженных отличиях.
  - Не делай невинное лицо. Тебе не идет.
  - На самом деле это было виноватое лицо, сэр.
  - Тем более. Оставь обычную хитрую рожу.
  Сергей попытался улыбнуться. Разбитая губа еще болела, в ушах звучал девичий голосок: "Ничего страшного, все хорошо".
  - Ты что, и вправду сожалеешь о своих действиях?.. А если бы они переломали себе кости? Если бы растерялись и не восприняли твоих указаний, когда бы ты соизволил их дать?
  - Тогда вы бы уволили меня, а в больнице всем пострадавшим сделали множество анализов. Столько, сколько надо, чтобы найти вектор. Я решил, что Умник едва ли подстраховался на такой случай: наш поход был экспромтом. И еще я подумал, что Умнику в больницу не захочется, поэтому он или она покажет свой максимум.
  - Ты ждал, что это окажется девчонка?
  - Нет и да. Я обратил внимание, как она ест цветной сахар: кусок за куском, меня едва не затошнило. Я читал где-то, что клетки мозга питаются глюкозой. Но на самом деле среди них не было неподозрительных.
  - Как тебе вообще пришло в голову тащить их на Столбы?
  - Я предположил, сэр, что вы меня не похвалите, если я устрою пожар или взрыв в лабораторном корпусе, - безмятежно сказал Сергей.
  - Спасибо, что подумал об этом.
  - А кроме того, пожар трудно организовать так, чтобы испугались не все.
  - Извини?
  - Ну, если уж кричат "Пожар!" или "Метеорит!", испугаются все и сразу. А мне хотелось, чтобы Умник первым понял, насколько серьезна опасность. То есть раньше остальных.
  - Ты хочешь сказать, что падение с трехсотметровой высоты - опасность неочевидная для среднего ума?
  - Вы будете смеяться, сэр, но нет. Ведь мы же не падали, мы скользили вниз, и поначалу достаточно медленно. Надо было сообразить, что скорость растет каждую секунду, что "гекконы" долго не выдержат и что после этого мы полетим так же красиво, как с Моста самоубийц. Причем меньшее ускорение вполне компенсируется большой высотой. Ей хватило десяти секунд, чтобы понять и придумать решение. Она кричала от ужаса, когда все остальные были только слегка встревожены. А когда до остальных дошло, их уже держали тросы.
  - Ты проклятый псих, Островски. Чем ты вымазал Столбы?
  - Техническим силиконовым спреем, сэр. Не забыть бы потом его удалить. Я попросил Зосю разместить сообщение на нашем форуме, чтобы туда пока никто не поднимался, - причины выдумал, конечно. За подлянки со спреем среди мун-альперов... гм... бьют морду.
  - Кстати, а эту Зосю ты зачем взял с собой?
  - Мне нужна была шестая точка, иначе... ну, в общем, не получалось. И я ничего ей не рассказывал про вектор.
  Сергей посмотрел, как шеф наливается кровью, и добавил:
  - На самом деле у нас с Зосей было еще по паре выкидных тросов. Убиться насмерть мы бы им не позволили. Только слегка поломаться, в самом худшем случае.
  - Молодец.
  Картер помолчал, вздохнул, активировал электросигарету. Причем умудрился сделать это так медленно, будто закуривал сигарету настоящую. Сергей понял, что пауза предваряет его реплику.
  - Сэр, Амритрай прошла обследование?
  - Прошла.
  Шеф опять умолк. Сергею стало нехорошо - почти как давеча у Столбов.
  - И результат? - Спасибо, хоть голос не дрожал.
  - Вектор нашли. И еще кое-что нашли.
  Ага, теперь мне полагается вопросить: "И что же нашли, сэр?" - Не дождешься, старый хрен. Если я был прав и задачу выполнил, нечего надо мной издеваться. Сам скажешь.
  - Она беременна.
  - Кто?.. Как?
  - Обвиняемая. И я думал, ты знаешь, как это бывает.
  - Я имел в виду, почему... То есть зачем. Зачем ей это надо.
  - Наконец-то правильный вопрос. Она тебя все-таки обыграла в последнем раунде. Хорошо, хорошо: нас. И не в последнем, а с самого начала. Мы полагали, что Умник намерен как можно скорее отправиться на Землю, и просчитались. Беременная женщина не может совершать космический перелет, даже с Луны на Землю, основание - интересы ребенка. Она также не может подвергаться никаким процедурам генной терапии, кроме тех, что входят в список А43. То есть извлечь этот вектор из ее организма мы не можем. Более того, будущий ребенок тоже должен быть носителем.
  - А кто отец? Они узнали?
  - Она сама сказала, - Картер невесело ухмыльнулся. - Баумгертнер. С ним я сам поговорил... ну и тип. Сказал мне, что она заявилась к нему в комнату и совершила провоцирующие действия.
  - Аруна?
  - Что тебя так удивляет? Расчет был точный. Парень не из тех, кто отказывает дамам. Даже сейчас, уж на что психовал, а когда начал рассказывать об этом - губами зачмокал.
  - Постойте, а как насчет противозачаточного имплантата? Мне казалось, их носят все женщины в Сэнгере.
  - И тут ты в теме, - не без ехидства заметил Картер. - Я спрашивал у врача. Имплантат у нее на месте, и он неактивен. И теперь уже нельзя доказать, что она сама его инактивировала. Если имплантат не срабатывает - а изготовитель предупреждает, что в одном случае на миллион такое может произойти, - то он инактивируется сам при изменении гормонального статуса женщины.
  - Мне трудно поверить в такую случайность.
  - Мне тоже. Как и во внезапную вспышку роковой страсти.
  Сергей вспомнил Эрвина и Аруну за столиком. Так это было не совращение юной девы, а попытка поговорить с любовницей? Которая сначала бестрепетно объявила, что хочет заняться сексом, а потом - что больше не хочет, и, возможно, не снизошла до пояснений... Теперь его вышлют на Землю. И он даже не узнает, за что.
  - Хорошо, но что будет дальше? На что она рассчитывает?
  - Спроси у нее.
  Сергей поднял глаза на шефа.
  - Она хотела тебя видеть. Разрешение тебе дано. Но, сам понимаешь, по результатам разговора отчитаешься.
  
  
  ***
  
  Бежать на Сэнгере некуда, и специальных мест заключения нет. Есть комнаты в госпитале, предназначенные для временной изоляции лиц с симптомами нервных расстройств или передозировки этанола. В одну из таких комнат и поместили Аруну. О дополнительной охране она, вероятно, догадывалась. С другой стороны, не может же сколь угодно умная девчонка осуществить побег с базы на корабле? В одиночку такие дела не делаются.
  Существеннее то, что она, по-видимому, не хотела.
  Комнату сделали довольно уютной. Морской берег на оконном мониторе (картинка не из стандартного набора - на пляже мусор, какие-то лодки, не особенно живописные), работающий терминал, два кресла и выдвижная кровать. У терминала - колба с диковинным желто-синим цветком.
  Аруна сидела в кресле. Она распустила косу (для томографии попросили, подумал Сергей), разделила волосы надвое и завязала узлами ниже ушей. Черные пряди плащом накрывали ее плечи и сбегали вниз, почти достигая пола. Она выглядела спокойной и веселой. Такой же, как на пятничной вечеринке. Или немного другой, кто их разберет, девушек.
  - Здравствуйте. Я ждала вас... э, как вас зовут на самом деле?
  - Сергей.
  Она фыркнула.
  - Ну, здравствуйте, Сергей. Я хотела сказать, что ваша выдумка была отличной.
  - Вы поняли, что это ловушка? (Она кивнула.) Когда?
  - Поняла, когда вы начали рассказывать, как это безопасно.
  - Я где-то проврался?
  - Нет, наверное. Я ничего не понимаю в мундеринге, но... я заметила, что вы врете.
  М-да. И я ведь замечаю, когда кроха Джонни хитрит: "Дядя Серж, да мне просто мама велела не есть брокколи!" Я ничего не понимаю в брокколи - мало ли, вдруг на него бывает аллергия, - но услышав это "мама велела не есть", сразу позвал сестру. А Джонни, наверное, тоже казалось, что он врет убедительно, и с товарищами по детскому садику такое, вероятно, прокатило бы. Многофакторный анализ, чтоб его.
  - Почему же вы не отказались?
  - Не было хорошего предлога. Все уже знали, что день у меня завтра свободный. Я думала, не сказать ли, что плохо себя чувствую. Но Кэтрин сообщила бы врачам, а я не планировала сдавать анализы так рано. То, что вы со временем до меня доберетесь, я понимала, но хотела еще две недели... Вот и подумала, что смогу как-нибудь выкрутиться.
  - Но не смогли?
  - Я хотела молчать, думала, вы не выдержите. Ведь у вас был запасной вариант. Но потом мне стало страшно. Я подумала: вдруг что-то пошло не по вашему плану и вы правда не знаете, что делать? И сами погибнете, и наши... Глупо, конечно. Но я испугалась.
  - Извините меня, Аруна. (Ага, Островски, добавь еще "не мы такие, служба такая".) Если бы я знал, что вы в положении...
  Она рассмеялась.
  - Но вы не могли этого знать. А ваша подруга мне прислала цветок. Она тоже у вас работает?
  - Нет, она действительно ботаник. Аруна, я могу задать вам вопрос?
  - Конечно, можете.
  - Чего вы добиваетесь? Вы хотите остаться в Сэнгере?
  - Да.
  - И вы для этого соблазнили Баумгертнера?
  - Соблазнила? Как это говорится - да будет стыдно тому, кто подумает дурно!
  Глаза Аруны блеснули, она сжала губы так, будто сдерживала смех. Сергей смутился самым дурацким образом, от души надеясь, что она хотя бы не читает мысли. Детский смуглый пальчик с розовым ноготком водит по черным и алым буквам на волосатой коже: "На каком это языке, Эрв?.. И что это значит?" И волосы, шелковым крылом переброшенные через плечо, и вовсе не детская грудь, и этот придурок, счастливый и самодовольный... Сергей покрутил головой, отгоняя просящиеся на язык формулировки вроде "цинично использовала".
  - Мне нужен ребенок, - просто сказала она. - Ввести этот вектор взрослому - полдела, надо, чтобы он был с рождения. Я хотела близнецов, жаль, что не получилось. Думаю, я буду хорошей мамой... если они мне позволят. А Эрвин умен, и он неплохой человек. Передайте ему, пожалуйста: я рада, что отец именно он.
  - Его теперь, вероятно, отправят на Землю. И если без черной метки в личном деле, это можно будет считать везением.
  Она дернула плечом: школьница-хулиганка, которую стыдит учитель.
  - Он ни в чем не виноват, сексуальные контакты на базе не запрещены. Никто не мог знать, что имплантат не сработает. И ему на Земле будет лучше. (Сергей в свою очередь подавил улыбку: она говорила как будто о дикой зверушке, которую необходимо выпустить в естественную среду обитания.) И он будет соавтором статьи, Кэтрин об этом позаботится: она щепетильна в таких вопросах.
  Героем статьи он будет, "практически здоровым мужчиной Б.", биологическим отцом Того Самого Ребенка, мрачно подумал Сергей... стоп, она, кажется, о чем-то другом?
  - Какой статьи?
  Она взглянула с недоумением:
  - Ну, мы ведь получили довольно красивые результаты. Это надо публиковать, а Эрвин участвовал в работе, Кэтрин его не выкинет из списка авторов. Но он теперь вернется на Землю и там примкнет к какой-нибудь научной группе. Ченнаи, Беркли, Пущино - после Сэнгера его возьмут куда угодно, на его выбор. И к тому же он в курсе наших идей. Понимаете, в нашей работе важен даже намек на то, где искать и как. Это очень ценно, и он будет в своем праве, если расскажет новым коллегам. А Кэтрин это понимает, значит, она будет форсировать работу! Чтобы наша статья вышла первой.
  И замолчала, как будто сказала все, что нужно.
  -Наверное. И что?
  Аруна снова рассмеялась.
  - Кэтрин сделает все, чтобы я могла продолжать работать. Даже в статусе обвиняемой. Даже беременная. Кэтрин и Йозеф, они оба. Я буду продолжать работать.
  - Ну это, положим... (А, собственно, почему нет, Островски, назови хоть одну причину...) С этой штукой в крови вас никто не пустит в лабораторию.
  - На лабораторию я плевала. Вводить программы синтеза возьмут новенького, желающих на Земле полным-полно. Мне нужен только компьютер.
  - Вы уверены, что вам это позволят?
  - А вы знакомы с доктором Хиггс? - вредным голосом спросила школьница и показала пальцем себе на губы. У Сергея они были уже нормального размера, но ссадина осталась. - К тому же Йозеф. Он из тех немногих, кто делает честь Сэнгеру своим присутствием, а не наоборот. Когда он скажет, что я должна продолжать работать, больше вопросов не будет.
  Ее самоуверенность раздражала.
  - "Когда", а не "если". Почему вы думаете, что ваш поступок их не шокирует? В конце концов, вы сами говорите, что желающих работать в Сэнгере много. Зачем им связываться с обвиняемой в серьезном преступлении?
  - Зачем... У вас в Европе есть легенда об ученом, который продал душу демону, чтобы получить знание. Это про таких, как Йозеф и Кэтрин. Они бы погрозили мне пальцем, если бы узнали, что я хочу сделать. Но после того как я это сделала - они не откажутся от меня.
  - Так они знают... какое обвинение вам предъявлено?
  Аруна молча улыбнулась. Это как понимать - знали с самого начала, все это время знали? Или узнают теперь, что бы ни планировала по этому поводу служба безопасности? Все равно что пасти стадо павлинов... Хочу на Землю. Патрулировать окраинный городской квартал, где самый коварный криминальный замысел направлен на взлом банкомата. И конечно, она права насчет них. Кэтрин танцует - пылающий факел победы... "В чем бы ни обвиняли, это не может быть важнее... зарубите на носу..."
  - А вы демон, Аруна?
  - Не знаю. Вопрос дефиниции. Мне сказали, что я существо с нечеловеческими способностями. Но это обычно значит - со способностями, которых нет у большинства людей.
  Он увидел краем глаза, что картинка на тач-скрине погасла и сменилась текстом. Узкая колонка, длиннохвостые буквы незнакомого алфавита. Стихи, молитвы?
  - Аруна, а если я спрошу, зачем вообще вы это сделали? Вы не ответите?
  - Отвечу. Было бы неплохо, чтобы об этом знало одним человеком больше. Тем более, вы не связаны с наукой и не собираетесь оставаться здесь надолго.
  - Я давал подписку о неразглашении.
  - Это неважно. Понимаете, мне очень хотелось решить задачу, за которую мы взялись. Я должна узнать, как это устроено на самом деле. Этот механизм старения, в нем есть что-то... - Она замолчала, пощелкала пальцами. - Негармоничное, наверное, так можно сказать. Я сейчас хорошо это понимаю, но вам не могу объяснить, тут нужна математика. Кэтрин с Йозефом понимают. Вот: он как будто внешний по отношению к системе, он не завязан на нее. Ну, как будто вы видите гладкую асимптоту, и вдруг на ней перелом и пик... Это не так сложно, как кажется, вполне можно найти... Не знаю, понятно ли это вам. Вы ведь не ученый.
  - Я сыщик, - серьезно ответил Сергей. - И, наверное, я понимаю, как можно очень сильно хотеть решить задачу.
  - А, в самом деле. (Улыбка у нее была очень хорошая.) Вы когда-нибудь рисковали жизнью, чтобы довести до конца расследование?
  - Бывало... - он осекся. - Аруна, а вы?
  - Вектор не тестировали на людях. Я посчитала сама - риск невелик, около одной тысячной, если я ничего не упустила. Это ненамного больше, чем у любого обитателя Сэнгера.
  - А в чем риск?
  - Нарушения синаптических контактов. С разнообразными последствиями. Но в любом случае это нескоро, должны пройти годы.
  - Аруна!..
  - Мне нужно это сделать, - произнесла она раздельно, будто заклинание. - Я еще раньше догадывалась, как это называют - интуитивно чувствовала, что старение - болезнь. Такое же генетическое заболевание, как другие - у одних людей они есть, у других нет. Оно локально, оно не может быть всеобъемлющим, эволюционно запрограммированным механизмом. Но интуитивные догадки ничего не стоят. На Земле тысячи ученых говорят и пишут то же самое, и никто из них не имеет хороших доказательств, а аргумент против - неотразим: все живое смертно. Я должна была получить доказательства. Понимаете?
  - Понимаю, - сказал Сергей. Он действительно понимал. Это страшное дело, когда уже знаешь ответ и между преступником и тобой стоит только твоя собственная тупость - окажись у него под рукой такой вектор...
  - Так что же, люди будут жить вечно?
  - Не сразу. Смертность многофакторна. Но лет на двести для начала мы можем рассчитывать.
  Лет на двести... Сергей уставился в пол. Предположим чисто теоретически: что произойдет, если Картер завтра прикажет добавить ей в кофе нейротоксин, не оставляющий следов - под свою личную ответственность? Скоропостижная смерть юной особы, которая самовольно ввела себе несертифицированную генетическую конструкцию, - событие прискорбное, но не слишком подозрительное, и все проблемы разом будут решены. Проклятье, будь я на месте Картера... Да нет, ничего не выйдет, Кэтрин догадается ее прикрыть - срочно докажет, что вектор не летален, а если надо, сама будет есть с ней из одной тарелки, всю группу не ликвидируют... Стоп, я что, желаю им удачи?!
  - Я слышал, что резкое продление жизни опрокинет экономику, вызовет социальную напряженность. Вы не боитесь этого?
  - Бояться глупо.
  - Кстати, разве такие работы не должны быть запрещены?
  Тут она рассмеялась в голос.
  - По вашей логике - конечно, должны! Но наша группа ведет свои исследования официально, они включены в план работ Института. Возможно, все они подсознательно уверены, что результатов не будет, но ставить амбициозные цели полезно для имиджа. Хотя то, что эти работы ведутся здесь, а не на Земле, - не случайность. Но если открытие сделано, его невозможно засекретить. Если опубликованы предыдущие шаги - велика вероятность повторения. Все равно что дописать начатое слово. Кэтрин не зря боится утечки информации.
  - Так вы еще и поэтому подставили Эрвина? Чтобы тот, кто знает достаточно много, оказался на Земле?
  Аруна кивнула.
  - Но все-таки - что если начнется ненависть между долго- и короткоживущими, экономический коллапс, разрушение социальных структур? Шесть поколений семьи в одном доме - как вам такая перспектива?
  - Мне кажется, это будет интересно.
  - И кто, по-вашему, будет со всем этим разбираться?
  - Мы. Такие, как я. (Она коснулась пальцем виска.) Когда не будет другого выхода. Будьте уверены, здесь найдутся и другие желающие получить вектор.
  И то правда, растерянно подумал Сергей. Разбираться с нечеловеческим бессмертием посредством нечеловеческой мудрости. История прекратит течение свое и начнется заново...
  - И вас не ужасает идея неравноправия? Разделения на бессмертных и смертных?
  - Если бы так рассуждали всегда, не было бы изобретено ни одно лекарство. Когда первые инъекции инсулина спасали больных, другие диабетики в это время умирали. Те, кто делали первые уколы, думали о спасенных, а не о справедливости.
  - Здесь другое, - он не мог так просто сдаться девчонке, пусть даже... - Новое расслоение будет длительным. Вы же понимаете, что все человечество этих ваших векторов не получит? Кто-то откажется по соображениям религиозным или из страха, а кто-то просто не будет иметь такой возможности. Вы в курсе, что у нас существуют страны третьего мира, где заработанных денег людям хватает ровно на еду, а бесплатная медицина остается на уровне двадцатого века? И что тогда? Каста бессмертных обгонит остальное человечество? - он старался, чтобы это прозвучало не обвинением, а уточняющим вопросом, но не мог сдержать раздражения.
  Аруна опять рассмеялась.
  - Раз уж мы заговорили о кастах и третьем мире - в моем родном городе юридически у всех каст равные права, но все знают про каждого, кто к какой касте принадлежит по рождению. Это плохо, но это не конец света, как представляется европейцам. Можно выработать правила, которые позволят жить с неравенством, пока не достигнуто равенство. А можно делать вид, что неравенства не существует. Кстати, вас не шокирует, что ожидаемая продолжительность жизни в цивилизованных странах почти вдвое больше, чем в Африке? Это не рушит мировую историю?
  - И к какой касте принадлежите вы? - буркнул Сергей. Аруна не ответила.
  - Зачем вы рассказали мне все это?
  - Я подумала, что вам захочется узнать, - с невинной доброжелательностью ответила она. - Вы потратили столько сил... От местной Сети меня пока отрезали, но разговаривать со знакомыми не запретили.
  Отключение принадлежало к числу самых жестких мер. Видимо, на лице Сергея отразилось сочувствие, потому что она добавила:
  - Доступ к библиотекам мне оставили. К рабочим базам - пока нет, а читать разрешили.
  - И что вы читаете?
  - "Ригведу". - Она как будто смутилась. - Мы ее проходили в колледже. Я не любила древнюю литературу, у меня по гуманитарному блоку был средний балл. Думала, это скука, архаика - гимны забытым богам, сотворение мира из тела первочеловека, который почему-то был прежде всего мира... сплошные нелепости. "Когда Пурушу расчленили, на сколько частей разделили его?"
  Протянув руку над столом, она провела указательным пальцем по экрану, выделив фрагмент, потом мизинцем стукнула на "перевод":
  - "Луна родилась из мысли, из глаз возникло солнце, из уст - Индра и Агни, из дыхания возник ветер. Из пупа возникло воздушное пространство, из головы развилось небо, из ног - земля, стороны света - из уха. Так они устроили миры..." - нас это заставляли учить наизусть! На языке оригинала звучит не так нелепо, даже поэтично. Теперь мне захотелось перечитать. Наша учительница была бы рада, она со мной намучилась.
  - Аруна, вы не вернетесь на Землю?
  - Не знаю.
  
  
  ***
  
  В "Горной Луне" появилось вино с Земли. Белое, полусладкое, название и Сергей, и Зося видели впервые, но какая разница? Важно, что оно (с высокой долей вероятности) сделано из винограда. Снова был вечер, и граница между тускнеющим золотым и темнеющим лиловым стояла точно над их столиком.
  - Жалко, что нарушителем оказалась девочка, - сказала Зося. - Я хотела, чтобы этот, ну, такой... - она очень похоже изобразила сладкую улыбку Эрвина, взмахом пальца обозначив эспаньолку.
  - Чем он тебе не угодил?
  - Ты еще спрашиваешь!..
  - Не буду, не буду, пани. Он тоже свое получит.
  - А, хорошо. Но девочку мне очень жаль. Что она сделала, ты не можешь рассказать?
  - Не могу. Хотя... Слишком умная даже для Сэнгера.
  - О, это серьезно. Всегда знала, что женщине слишком умной быть плохо, - Зося очаровательно приподняла брови. - Не знала, что за это сажают в тюрьму.
  - Это как выйдет, шановная пани. Некоторые могут отвертеться. За тебя!
  Прозвенело стекло, на веранде зажегся автоматический фонарь. Отступил в сумерки вид за парапетом - огоньки в окнах домов, живые кристаллы теплиц, механическое шевеление промышленной зоны, черная вертикальная черта Столбов.
  - Ты грустный. Твой Картер недоволен?
  - Он всегда недоволен, но именно сейчас - не мной. Это ты меня спасла.
  - Вот еще, глупости! Тогда что же?
  - Так, строчка привязалась, вертится в голове. "Луна родилась из мысли..."
  - Из мысли? Странно, да. А дальше не помнишь?
  - Не-а. - Он взял ее руку, другой рукой поднял бокал, отхлебнул вина, пахнущего виноградной шкуркой. Озноб понемногу проходил. Сидишь за столиком с девушкой, вокруг темнеет и пахнет цветами, и вы оба внутри стеклянной капли на каменной серой шкуре Луны. Как детский "секретик" с золотой фольгой, зарытый на пустыре.
  - Знаешь, это все хорошо - все эти мономолекулярные полимеры, фотонакопители и гелий, - сказал он, старательно выговаривая длинные слова. - Но материал, из которого делается новый мир, - это человек. Другого подходящего материала в мироздании нет. Понимаешь?
  - Понимаю, - с готовностью ответила Зося. - Ты больше не пьешь, или налить еще?
  - Еще.
  
  
  
  Дело об украденной трилогии
  
  Все способы хищения информации, описанные в рассказе, являются вымышленными. Все совпадения случайны.
  
  - Человечек с Луны упал с вышины... - Сергей Островски приподнялся на низком диване и метнул дротик в мишень, висящую на стене. Шестьдесят очков - моторные навыки окончательно вернулись, мышцы привыкли к земной силе тяжести. Стрелок под рукой больше не было, но вставать не хотелось. - Человечек с Луны... упал с вышины...
  Играешь сам с собой в дартс (неизменно выигрывая), бормочешь детский стишок, и чтобы предпринять простое действие, необходимо время - собраться с силами. "За рубашкой в комод полезешь, и день потерян". Сергей не помнил, когда в последний раз надевал рубашку, давно уже обходился одноразовыми футболками. Когда приходит такая полоса, лучше всего, чтобы раздался сигнал вифона и тебе назначили срочную встречу. Чтобы не было времени раздумывать, так ли мне это надо, а пришлось бы вскочить и побежать... О да, наконец-то.
  - Островски.
  - Серж, привет. Это Дон, помнишь меня?
  - Тебя не забудешь! Привет, Дон, - Сергей зашарил по рабочему столу, включая видеокамеру и вытаскивая вертикальный экран.
  - Я видел в Сети, что ты вернулся.
  - Да, еще в июле. Деньги у меня на счету, теперь не торопясь ищу новую работу.
  - Как жизнь на Луне?
  - Неописуемо. Как сам?
  - Честно говоря, плохо. - И в самом деле, Дон был бледен, говорил не своим каким-то, придушенным голосом, да и глядел тоскливо. - Серж, прости, что так сразу, но у меня к тебе громадная просьба. Если ты сейчас свободен, ты мог бы меня очень сильно выручить.
  - Что у тебя стряслось?
  - Это связано с моей работой. Я не могу об этом по открытому каналу, ты же понимаешь, о чем я?
  - Ничего я не понимаю. - Дон Барни, насколько помнил Сергей, работал в службе безопасности крупного издательства. Что там могло приключиться такого таинственного, о чем нельзя говорить по вифону? - Марио Камата внезапно скончался?
  Дон отшатнулся, будто обжег нос, и уставился в камеру круглыми глазами:
  - Ты уже знаешь?!
  - Говорю тебе, я ничего не знаю. Просто глупая шутка, извини. А что, он действительно умер?
  - Нет, не совсем... то есть не умер... - Дон отер лоб бумажным платком. - Что я говорю? Совсем не умер, с Каматой все в порядке. Это его книга... Серж, я тебя прошу! Коптер за мой счет до меня и обратно, любая жрачка... для тебя, я не буду, - сдавленно договорил он. - Офицер должен оказывать помощь больным, так?
  - А что с тобой?
  - Отравился какой-то дрянью, - На лице Дона появилась умоляющая ухмылка, почти как раньше, когда они сидели за соседними терминалами перед зачетом по сетевому поиску. - Я бы сам к тебе прилетел, но не могу отойти от сортира дальше чем на пять минут бегом.
  - Ох. Мои соболезнования.
  - Спасибо. И знаешь что? Это наименьшая из моих проблем.
  - Все понял, вылетаю.
  
  
  Сергей едва успел натянуть чистую футболку, как на вифон отзвонился пилот. Значит, прилетел по экстра-тарифу. Покатают бесплатно над великим городом да еще загадку загадают - жизнь явно идет на лад.
  Мир медленно поворачивается под ворчание винта. Облака в жарком голубом небе неподвижны, а внизу появляются и пропадают ослепительные кристаллы зеркальных небоскребов, светло-коричневые старые здания, разделенные темными траншеями улиц, и поблескивают на свету прозрачные трубки овервея - как будто свернутая петлями леска на россыпи камней. В тенистых провалах клубится зелень парков, а у горизонта, за ломаной линией самых далеких крыш, натянуто синее полотно океана. Чудовищный мегаполис - мегалополис, как выражалась одна знакомая Сергея, - занимает площадь, на которой с удобством разместилось бы небольшое европейское государство, и даже "летучее такси" пересекает его не менее чем за полчаса.
  ...Со стороны это не выглядело как растерянность или депрессия. Утро в Лучшем Городе Мира, в студии дальнего родственника-дауншифтера, пропадающего на тихоокеанском острове. (Стоило ему ехать так далеко, и чем многоквартирный дом не тот же остров?) Окно выходит на запад, и утро заполняет комнату ясным бледным свечением, отраженным от зеркального дома напротив. Стакан апельсинового сока, живого, не синтетического. Пробежка в парке, где листву шевелит ветер, в восемь уже припекает солнце, а иногда льет настоящий дождь. Родные для горожанина запахи: скошенная трава, пицца и жареные сосиски, капли мороженого на горячем асфальте, пот и духи, средневековая вонь мусорных баков и проходов между домами... Гул голосов, шорох колес и двигателей, собачий лай, обрывки уличной музыки... И чириканье воробьев. Там не было птиц.
  Разумеется, он не просто бездельничал и просаживал заработанные деньги. Он повышал квалификацию, занимался самосовершенствованием. Студия восточных единоборств, курсы полицейского управления по кодифицированной коммуникации, пара мастер-классов для общего развития. Уйма новых знакомств, полезных и бесполезных... впрочем, при его профессии могут ли знакомства быть бесполезными? А по вечерам - клуб с музыкальной программой, домашний вечер с фильмом или книгой, ужин с девушкой, без серьезных намерений, хотя кто может знать заранее... Вот только когда в сизом небе был виден розоватый ломтик луны, он старался сесть спиной к окну. А на вопросы о том, как ему работалось по небесному контракту, отвечал такими скучными шутками, что даже самый тупой собутыльник не переспрашивал.
  В общем, звонок Дона пришелся кстати.
  
  ***
  
  Дон оказался еще толще, чем запомнился, и начал уже лысеть со лба. Зато квартира у него отличная, лучше, чем у кузена Алекса. Из окон виден обширный кусок неба, и барная стойка имеется. Правда, хозяин определенно не в том настроении, чтобы устраивать домашние вечеринки. Сергей уселся в кресло и поднял спинку до упора.
  - Слушаю.
  - Короче, ты знаешь, что в прошлом году "Долфин Букз" подписал контракт с Марио Каматой на издание его трилогии "Великая река"?
  - Дон, я был на Луне, а там ограниченный трафик и вообще не до высокой литературы. Неважно, теперь знаю. Это круто?
  - Ну, в общем, да, - раздельно произнес Дон. - Можно сказать и так. Это - очень круто. Возможно, это лучший литературный проект десятилетия.
  - Понятно.
  - Точнее, предполагалось, что это будет лучший проект. Все было в порядке - фанатские форумы, литературоведение, интервью - вся мировая культура, будь ей пусто, замерла в трепетном ожидании. А потом первую книгу украли. Извини...
  Дон вскочил, затоптался на месте, пытаясь сунуть ноги в тапочки, махнул рукой и убежал босиком. Не возвращался минут пять. Потом появился, еще бледнее и несчастнее, чем был, и сразу налил себе минералки.
  - В каком смысле - украли? - спросил Сергей.
  - В прямом. За неделю до объявленной премьеры электронной книги файл появился сразу на десятке пиратских ресурсов.
  - Лихо! Премьера затевалась помпезная?
  - Не то слово. Огромные мощности, мгновенный доступ для каждого жителя Земли и околоземного пространства. Одной техники сколько арендовали. Эксклюзивный дизайн портала, эксклюзивное интервью с Каматой, с матерью Каматы, с директором издательства, с нобелевскими лауреатами по литературе... Собственно, почти так все и прошло, только на три дня раньше.
  - Почему?
  - Чтобы угнаться за этими паразитами. Сам понимаешь, чем больше народу скачает долгожданный шедевр у пиратов, тем меньше доход издательства, который, кстати, уже поделен и частично израсходован. Моего шефа - он курировал защиту проекта, - естественно, уволили, назначили другого. Через полгода готовим к выходу вторую книжку - и та же фигня, ты представляешь?
  - Пытаюсь, - честно сказал Сергей. - Много было визгу?
  - Я пожалел, что не уволился после первой книги. Сотрудники издательства плюют в нашу сторону при каждой встрече - остались без годовой прибавки (хотя, прямо скажем, социально незащищенными они от этого не стали). Начальство... в грубой форме требует результатов. Знаешь, сейчас ловлю себя на том, что воспринимаю этот понос как везение, вроде как в школу не надо идти... В форумах анекдоты, видеоролики со слепыми дельфинами, в ньюс-порталах аналитические, черт бы их подрал, статьи о смерти издательского дела... И почему я не уволился хоть после второй книги!
  - Потому что не любишь пасовать?
  - Потому что идиот. Знал бы, что будет дальше... Короче, я так и не выяснил, кто из руководства меня настолько ненавидит, но месяц назад меня повысили.
  Сказано это было с такой обреченностью, что вывод напрашивался.
  - За третью книгу отвечаешь ты.
  Дон молча кивнул.
  - И как ты действовал?
  - А-а... Усилить меры безопасности я не мог: некуда усиливать. Подготовка издательского проекта подобного масштаба охраняется так, что следующая стадия - это концлагерь. Одноразовые робы, личные досмотры каждые двадцать минут, обритие всех волос на теле...
  - Серьезно, насчет волос?
  - Скажем так: я это обдумывал. По традиции все сотрудники, кто непосредственно работает с файлами, живут это время в здании, не выходят в город. Разговоры по вифону прослушиваются, почта просматривается. Даже если человек и не перешлет своей мамочке текст романа, он может случайно выдать спойлер - раскрыть сюжетный ход, сказать, чем кончится, а это почти так же плохо. На входе жесткая проверка, пронести копирующее устройство в сектор С нереально, ни в заднице, ни в зубном протезе. Вынести любым способом - тем более... В общем, не хуже, чем на Луне, я думаю?
  - Да, пожалуй. - Сергей вспомнил случай из своей лунной практики. Но там-то была лазейка, хотя... - Что, совсем не выходят все время, пока не состоится премьера?
  - Совсем не выходят. В утро премьеры отправляются по домам, вечером ужинают с владельцами издательского дома и журналистами. Все, включая корректоров и компьютерщиков. Традиция.
  - И кто эти люди? Много их?
  - С десяток. Редактор, художник-иллюстратор, корректоры-верстальщики. Дизайнер и айтишники - кто делает сайт под премьеру, кто отвечает за правильное представление текста во всех форматах, кто защищает от вандализма, чтобы хулиганы не могли плохие слова вписывать, кто от бесплатного копирования - сломают все равно, но пусть хотя бы попотеют, такова позиция начальства... Словом, дюжина человек, плюс-минус два. "Кротом" может быть любой из них. Если не принимать во внимание, что никто из них не мог этого сделать. Просто не мог.
  Дон скрючился в кресле, как стручок перца, по-стариковски опершись о подлокотники и свесив голову.
  - Кто-то из них участвовал в подготовке всех трех книг?
  - Хороший вопрос, - Дон нерадостно оскалился. - Редактор - любимица Каматы, он не будет работать с другим. Менять художника нежелательно, коль скоро он рисовал к первым двум книгам. Кстати, это не какой-нибудь студент арт-колледжа, это, на минуточку, сам Генри Мольвиг. (Сергей не знал, чем знаменит Генри Мольвиг, и Дон безнадежно махнул рукой.) Ладно, неважно. То же касается дизайнера и некоторых программистов: слишком круты. Кого можно было, тех заменили еще после первого раза, но это не помогло.
  - Критики, обозреватели, журналисты получили текст?
  - До премьеры не получат даже самые именитые.
  - Ты не упомянул еще пиар-отдел.
  - Решено, что они обойдутся синопсисом и цитатами по выбору редактора.
  - М-да... Значит, главные подозреваемые - редактор, художник и кто-то из программистов?
  - Или кто-то раз за разом подкупает корректоров либо верстальщиков. Или кто-то в издательстве, не из числа вышеназванных, получил доступ к файлам... У меня теперь в каждом компьютерном устройстве сектора С сидит программка, которая фиксирует любые перемещения файлов, а сами файлы защищены всеми возможными способами... но это дохлый номер, если какая-то сволочь просто фотографирует страницы.
  - И такое возможно?
  - Возможно. Мы анализировали пиратские тексты и нашли кое-что занятное. Замены букв, вроде ошибок распознавания, - таких ошибок, по идее, не должно было быть, если бы... О черт, извини... - Дон снова рванул с места. Через пару минут из ванной донеслось: - Да, и плотность ошибок была различной, в одних фрагментах больше, чем в других, значит, крали кусками и с разным качеством!
  - Дон, так чего ты хочешь от меня? - спросил Сергей, когда однокашник вернулся.
  - Чтобы ты поработал на "Дольфин". Сходи туда, посмотри свежим глазом... Ну, что я такого сказал?
  - Твое недомогание опасней, чем я думал! Кто меня пустит на ваш секретный завод?
  - А кто не пустит? - Дон опять невесело осклабился. - Служба безопасности? Я теперь служба безопасности, будь они прокляты. Я только что провел собеседование с Сергеем Островски и привлекаю его к расследованию нашей проблемы в качестве независимого эксперта. Разовый контракт по всем правилам, оплата затраченного времени, в случае успеха - сам понимаешь... Серж, я тебя прошу как друга. Вот, посмотри, - Дон крутнул пальцем по тач-скрину рабочего стола, разворачивая окно к гостю. - Я тоже не мальчик с леденцом, в Сети для меня мало секретного. Это болтовня на пиратском сайте. Они там уже расселись рядами и запаслись попкорном. Плевали они на роман, им, паразитам, интересен бесплатный цирк.
  - "Что с новым Каматой? - С Каматой все хорошо. Инфа из первых рук: дельфина уже поимели", - вслух прочел Сергей. - Пираты-зоофилы. Поздравляю.
  - Нет, как тебе это нравится? Работа с файлом едва начата, только редактор держит в руках полный текст, а они уже...
  - Только редактор?
  - Редактор - пожилая интеллектуалка, реликт бумажной эпохи, сильно удивлюсь, если это она. Прочие сотрудники работают с первыми тремя главами, остальное получат по мере ее продвижения. Серж... Я могу на тебя рассчитывать?
  
  ***
  
  - Мы приносим извинения, но ваш вифон придется оставить здесь. - Молодой человек был в штатском, но выражение лица имел военное.
  - Хорошо.
  - Имеются ли у вас иные устройства для копирования и пересылки файлов?
  - Нет.
  - Записывающая аппаратура - аудио, видео?
  - Не имеется.
  - Визиопротезы с функцией записи?
  - Простите, что?
  - Электронный глаз, очки.
  - Нет.
  - Мнемоэлектроника?
  Сергей открыл было рот, чтобы процитировать песенку про шпиона с фотокамерой в носу, но тут же в памяти возник изможденный Дон: "Серж, только, умоляю, не шути на контроле, только без этих твоих шуточек, парни делают свою работу..."
  - Не имею.
  - Владеете ли вы прогрессивными мнемотехниками?
  - В рамках полицейской академии.
  - Какой объем текста можете запомнить дословно?
  - Не знаю, давно не пробовал. Может быть, дюжину строчек. - С ума они тут посходили? Если правда, что инструкции пишутся по прецедентам - значит ли это, что за каждым вопросом угрюмого малого стоит прецедент? И кто-то фотографировал эксклюзивные иллюстрации электронным глазом, и кто-то дословно запоминал текст романа... Или это управленческая паранойя? С другой стороны, как ни крути, а книги Марио Каматы действительно украли.
  
  Ответив на еще полдюжины каверзных вопросов и дав торжественные клятвы не разглашать ничего из того, что ему доведется узнать о неопубликованном романе, Сергей наконец-то прошел в сектор С. Пробковые полы и тисненая кожа на стенах остались по другую сторону контрольно-пропускного пункта, в тех секторах, где принимают журналистов, крупных писателей и других бизнес-партнеров. Здесь было скромно, но не казенно, а уютно. Стены обиты деревом недорогих пород, кое-где картины, зеленая ковровая дорожка, на лестнице прихваченная медными прутьями, мягкий свет из матовых плафонов. Как будто гостиница где-то в горнолыжных Альпах - не хватает только зала с камином и кабаньей головой.
  Чем-то это напоминало, в самом деле, поселок на Луне. Все ингредиенты уюта - и жесткая изоляция по периметру.
  Впрочем, не настолько жесткая. Есть люди, которые приходят из внешнего мира и снова уходят туда. Есть окна, глядящие прямо в город. Есть, наконец, еда, которую привозят снаружи (надо будет выяснить, чем они тут питаются), есть вентиляция и канализация... ладно, начнем с более простых версий.
  
  
  Вероятно, Мелисса Гринуэй действительно была реликтом бумажной эпохи, и она точно была интеллектуалкой ("ДОКТОР Гринуэй, Серж, если скажешь "миссис", разговор с самого начала не сложится..."). Но назвать ее пожилой мог только бестактный озлобленный Дон.
  Любимый редактор Марио Каматы носила тонкие вытертые джинсы и растянутую майку-борцовку. Тинейджерская одежда совершенно не скрывала фигуру, безупречную в любом ракурсе: никаких обвислостей и складочек. Греховных мыслей это зрелище не вызывало, не более, чем мраморная статуя. Одно только преклонение перед могуществом бессмертного искусства и целеустремленностью художника. Наверное, дело было в ее лице. Эта особа могла исправлять тексты великого писателя и получать благодарности в ответ. Только посмел бы он не поблагодарить.
  - Я рада вам помочь, мистер Островски. Но уверяю вас, я уже рассказала все, что могла, и ответила на все возможные вопросы.
  - Все возможные вопросы никогда не будут заданы, доктор Гринуэй, - сказал Сергей с тонкой улыбкой (он надеялся, что именно с тонкой). - Конечно, по нашей вине: мы сами не всегда знаем, о чем следует спрашивать.
  - А, понимаю. Что ж, если придумали новые вопросы, давайте.
  - Вы работаете только здесь?
  - Да.
  Помещение напоминало одноместный номер в отеле. Скромная функциональная мебель, рабочий стол-пюпитр: хочешь - клади тач-скрин плашмя, хочешь - подними и установи вертикально, а рядом ставь чашку. На столе - бумажные листки и ручка для письма, птичье перо (довольно крупное, кремового цвета, с поперечными темными полосами), камешек (кажется, гранит, одна сторона отполирована), маленький детский рисунок в рамке, изображающий четвероногое животное. Окно с регулируемой прозрачностью, никаких жалюзи. Выходит на юг, открывает вид на другое высотное здание. Крошечный шкаф-холодильник, столик на колесах. За перегородкой, не доходящей до потолка, - очевидно, спальня и туалетная комната, куда соваться совсем уже неприлично.
  Все мило и невинно. И где-то здесь дыра величиной с Большой Каньон, в которую незаметно провалились два романа Марио Каматы, а сейчас просачивается третий.
  - Вот за этим столом?
  - Да, конечно.
  - Как вы полагаете, текст на вашем экране можно увидеть из окна?
  Мелисса Гринуэй одарила его долгим взглядом, отнюдь не восхищенным.
  - Поскольку я читаю с вертикального экрана, сижу лицом к окну, но не прямо напротив него, и оно большую часть дня наполовину зазеркалено... - протянула она. - Нет, возможно, я не заметила за окном человека в люльке, или с пропеллером, или с чем-то еще, который висел там все время, пока я работаю. Но ваши видеокамеры ведь не могли такое пропустить?
  Действительно, после первого инцидента все происходящее в помещениях сектора С фиксировалось видеокамерами. Теперь отдел Дона располагал многими сотнями часов интереснейших записей.
  - Это необязательно должен быть человек. Там могло быть что-то маленькое, например летающий бот. Но если вы поднимаете экран, тогда это и в самом деле не кажется реальным.
  - Вообще-то нас предупредили об этом еще полгода назад, - светски улыбаясь, ответила доктор Гринуэй. - Мы стараемся садиться так, чтобы работу не было видно из окна. Допустим, один-два раза я могла забыть об этом, но в целом старалась следовать рекомендациям. Что-нибудь еще?
  - Да, если позволите. Вы знакомы с Марио Каматой лично?
  - Разумеется.
  - Если верить его биографу, он своеобразный человек?
  - Это вежливый способ спросить, не мог ли он сам передать свой роман пиратам в обход договора с "Дольфин Букз"?
  - Не обязательно умышленно... - Сергей тут же сдал назад.
  - Марио Камата, мистер Островски, - ледяным тоном сказала Гринуэй, - ничего не делает неумышленно. Это не в его стиле. Ни в литературе, ни в частной жизни. И в любом случае это невозможно.
  - Почему?
  - Я думала, вы в курсе. Простое сопоставление показывает, что тексты были похищены уже после редакторской правки.
  - Но разве вы не посылаете ему исправленные тексты?
  - Я посылаю ему исправления, мистер Островски. Существенные исправления, которые требуют его внимания. Но не согласовываю с ним каждую убранную или добавленную запятую. Его доверие лежит в основе нашего сотрудничества. А свое мнение о пиратах и пиратстве Марио всегда высказывает достаточно ясно, и я его разделяю: это вопрос культуры общества.
  - Э-э... вы хотите сказать, что культурные люди не занимаются пиратством?
  - Культурные люди, мистер Островски, не скачивают произведений искусства с пиратских сайтов. Ведь и вы платите за утреннюю газету или одноразовую посуду, а не вытаскиваете то и другое из мусорных баков, хотя там бесплатно.
  И пока Сергей переваривал сопоставление утренней газеты с одноразовой посудой, а себя с культурными людьми (преисполняясь особой признательности за "ведь и вы"), доктор Гринуэй завершила свою мысль:
  - А теперь я вынуждена просить у вас прощения, но у меня сегодня много работы. Позволю себе заметить, что вам следовало бы лучше подготовиться к разговору.
  
  
  При взгляде на Мольвига вспоминались истории про эльфов, пристрастившихся к человеческим порокам, но неспособных спиться до смерти по причине бессмертия. Выглядел он лет на пятьдесят и был бы эффектен - острый профиль, усы и светлые волосы, не густые, зато длинные, - если бы не избыток роста при катастрофическом недостатке веса. Ощущалась в нем некая нереспектабельность, что-то из древних времен, когда в этом самом квартале обитала нищая богема и художник-иллюстратор на свой гонорар мог купить разве что колбасы. Даже коричневый загар как будто приобретен во время безденежных летних странствий, а чистые штаны и рубаха - только что подарены обществом "Женщины против алкоголизма". Впрочем, Сергей уже пошарил по Сети и теперь знал, кто такой Генри Мольвиг. В "Дольфин Букз" постарались заполучить все самое лучшее для проекта десятилетия. А при таком портфолио можно выглядеть как угодно.
  В отличие от редактрисы, художник встретил гостя дружелюбно. Может, ему надоело трудиться и хотелось поболтать.
  - Кофе, мистер Островски? - он прошел за перегородку, такую же, как в комнате у Гринуэй, и без церемоний поманил за собой Сергея. - Я добавляю корицу, вы не против?
  - Буду очень признателен. У вас есть кофе-машина?
  - У всех есть. Руководство проявляет заботу, - палец Мольвига застучал по кнопкам. Множественные коричневые ободки на прозрачном стекле кофейника, а также круги от чашек и бурые кляксы на всех горизонтальных поверхностях подтверждали, что заботу руководства он оценил в полной мере. - Фактически это как маленькая кухня - кофеварка, микроволновка, и мы можем заказывать любые вкусности, счета оплачивает издательство. Для обедов, конечно, тут есть кафе.
  - Вы можете заказать все, что захотите?
  - Хм... вероятно, я не могу заказать выточенного изо льда лебедя, полного черной икры, - задумчиво произнес художник. - Но на самом деле я еще не пробовал. А все мои пристойные желания удовлетворялись мгновенно.
  За перегородкой, помимо кухонного уголка, была кровать с переменной высотой изголовья, прикроватная тумбочка и шкаф. На кровати, прямо на смятом покрывале, лежал предмет, который в своем роде стоил ледяного лебедя. Присутствие его было... неожиданным.
  - Это детская вертушка, - вежливо объяснил Мольвиг, проследив направление его взгляда. - Я должен ее нарисовать. Извините, не могу рассказать подробнее. Собственно, тот факт, что я рисую вертушку, уже спойлер.
  Он поднял над головой игрушку и взмахнул ей, как ракеткой. Пропеллеры из разноцветной фольги весело завертелись, посверкивая под лампой.
  - Ее вы тоже заказали по Сети? (Интересно, а если понадобится нарисовать, допустим, широкополосный передатчик?..)
  - Не совсем так. Я посылаю свои пожелания администрации, там их просматривают и если не находят ничего предосудительного, то отправляют заказ.
  - Ваши заказы когда-нибудь отклоняли?
  - Нет, насколько помню. Вот наш кофе.
  Кофе был отличным, в меру крепким и сладким, и ненавязчивый запах корицы казался лишь особенностью сорта.
  - Вам нужно сделать много рисунков?
  - Что ж, полагаю, это не тайна. Примерно столько же, сколько и к предыдущим частям, - заставка и финальная виньетка к каждой главе, небольшие иллюстрации к основным эпизодам, несколько крупных. Показать не могу, сами понимаете.
  - Мне всегда представлялось, что иллюстрирование - нудная работа. Вы не страдаете от монотонности?
  - Да нет. Тут больше свободы, чем кажется. Даже такой зануда, как Камата - в хорошем смысле зануда, конечно, - не может описать все... весь видимый образ. Львиная доля остается нам. Я особенно люблю рисовать Марту. Она чудесная, хотя и дурочка.
  - А ваши иллюстрации пираты не похищали?
  - Эти, к Камате - нет. Украли только текст.
  - А другие? - Сергей задал вопрос из вежливости: в конце концов, после того как был принят новый закон об интеллектуальной собственности, крадут только действительно ценные вещи.
  - Что-то бывало. Но я плохо помню, что именно, этим занимаются мои агенты.
  - Я могу спросить о вашем рабочем процессе? Вы читаете главу?..
  - Увы, приходится, - Мольвиг комично поднял брови. - Рисовать картинки, не читая романа, - в этом выразилась бы высшая суть иллюстративной работы. Но господин Камата консервативен, он желает видеть именно то, что написал.
  - Вы при этом сидите за рабочим столом?
  - М-м, нет. Устаю долго сидеть, начинает болеть шея. Я читаю лежа - забираю текст в е-книжку и ложусь вот сюда, - художник махнул длинной ручищей в сторону кровати. - Показать, как?
  - Спасибо. - Кровать отделена от окна перегородкой, экран книжки повернут к изголовью... без шансов. - Всего наилучшего, мистер Мольвиг, простите, что помешал.
  
  
  У верстальщиков была общая рабочая комната. Сейчас в ней над огромным, в газетный лист, тач-скрином сидели двое - муж и жена средних лет, а может быть, давние коллеги, увлеченные профессиональным спором.
  - ...Но это не годится. Это просто ужасно, ты не согласен?
  - А иначе на малом формате плохо обтекает рисунок, тут длинные слова! Гляди, если три на семь дюймов, а пользовательский кегль больше десяти...
  - Ничем не могу помочь. Попробуй вспомнить, чему тебя учили.
  - Тогда я смягчу правила переноса? Только на этот абзац!
  - Ты еще трехколонником его разверстай.
  Судя по тону, последняя реплика была оскорблением. Сергей всегда считал, что очарование текста происходит от слов, из которых он состоит. Но от специалистов слышал, что это дилетантский взгляд, что истинное дао - в верном выборе шрифтов, среди коих бывают "плебейские" и "академические", а также ширины полей, размера пробелов между словами, расстояний между буквами и множества прочих вещей. В ответ на попытку Сергея представиться женщина, не оборачиваясь, рявкнула: "Через полчаса!" Мужчина совсем не отреагировал.
  Сергей почесал за ухом, присматриваясь. Страницы романа, увеличенные раза в четыре как минимум, выведены на рабочий стол и смотрят в потолок. Каждый фрагмент, по-видимому, задерживается на экранах подолгу, верстаясь под все возможные форматы, от настенного до наладонного. Пользователь в XXI веке платит не за контент, а за сервис, и должен получать за свои деньги максимум удобств и удовольствия, так, кажется?.. Работа у людей захватывающая, едва ли они обратят внимание даже на парочку горилл, играющих в баскетбол. А под потолком у нас... ага, вентиляционная решетка, затянутая какой-то сеткой, которая мешает видеть из комнаты, что там внутри, но не наоборот. Прилетайте, фотоботы, снимайте что хотите. Проклятье, да не только леталки - там может сидеть здоровенный "краб", под завязку набитый фотографиями страниц, и никто ничего не заметит!.. На самом деле, скорее всего, Дон проверил эту возможность, однако вопрос поставим.
  Но если бы в прошлые разы воровали этим способом, то украдены были бы также иллюстрации Мольвига, верно? Верстальщики над тем и трудятся, чтобы наиболее эстетичным образом совместить картинки с текстом. Вряд ли пираты уважают и боятся Мольвига больше, чем Камату, или ценят его творчество меньше. И уж наверное они не стали бы выбрасывать то, что само пришло им в руки... Ладно, смотрим дальше.
  
  
  Программисты работали каждый в своей комнате, координируя действия по локальной сети, как сказал Сергею руководитель группы IT Чарльз Маккласки. Чарльзу было лет двадцать пять, круглые оттопыренные уши и клочковатые бакенбарды делали его похожим на шимпанзе с рекордным IQ. На очень раздраженного шимпанзе, который уже полчаса не может добраться до банана и вот-вот запрыгает на месте, вопя от ярости.
  - Над чем работаете лично вы?
  - Защита файла после публикации.- Маккласки по-обезьяньи оскалил зубы. - Защита от неоплаченного копирования, защита от вандализма, защита от несанкционированного доступа при сохранении всех прав честных читателей... и угадайте, что я думаю? Что мы работаем впустую! Запираем конюшню, после того как лошадь украли! Когда вы найдете утечку, черт подери?
  - Мы делаем все возможное. Кстати, об этом я и пришел побеседовать. Как функционирует ваша локальная сеть?
  Маккласки начал рассказывать, как функционирует сеть, но Сергей слушал его вполуха. На подоконнике стояла светодиодная настольная лампа.
  Про такие штуки он читал, сам, правда, не сталкивался. Все, что нужно, - светодиоды и несложное устройство, изобретенное еще в начале века, которое с высокой частотой модулирует их свет. Глаз не видит никакого мерцания, а оно есть. Получается канал передачи информации, до изумления широкий - сотни мегабит в секунду. Видео переслать можно, не только что, смешно сказать, роман.
  Слушая о структурированной кабельной системе и контроле доступа, понимающе кивая, Сергей незаметно продвигался к окну. Ну естественно - что можно увидеть из окна дома в Большом Городе, как не другой дом? Сотни окон, не так уж далеко, и в любом может быть фотодетектор. Вот она и дыра.
  Лампа выключена. Понятное дело - сейчас солнце мешает, расстояние все же немалое. Но он ведь всю ночь здесь? Как бы в рассеянности, Сергей подвигал осветительный прибор (а цоколь-то тяжеленький)... Маккласки запнулся и вопросительно взглянул на него:
  - Это лампа, мистер Островски.
  - Да, извините, я задумался. Вы увлекаетесь светодиодными устройствами?
  - Нет, почему вы так решили? Просто вечером ее включаю, когда устаю от верхнего света.
  Ага. На подоконнике. Поставьте на окно лампу, мисс Стоунер, это будет нам сигналом... Не спугнуть бы его - пусть лучше остальным займутся ребята Дона. Кроме того, Сергей внезапно ощутил настоятельную внутреннюю потребность прямо сейчас свернуть беседу. Ох...
  - Я понял, мистер Маккласки. Спасибо за сотрудничество.
  - Удачи вам, - снисходительно пожелал лопоухий Чарли.
  Сергей вышел в коридор и замер, прислушиваясь к своим ощущениям. Похоже было на то, что удача изменила ему по-крупному.
  - О нет. Только не это!..
  
  ***
  
  Универсальные таблетки от поноса не помогали. Аюрведические пилюли, предложенные доброй соседкой, - тоже. Сергей рухнул на диван, натянул на себя плед и поджал ноги. Босые пятки мерзли, в теплом халате было жарко и прошибал липкий пот, в одной футболке и трусах - холодно. Бедный я. И бедный Дон. Кстати, на вифоне от него новое сообщение. Лампу у Чарли изъяли и не нашли в ней ровно ничего необычного. И заказана она была всего две недели назад, и раньше никаких похожих ламп не было ни в комнате айтишников, ни у кого-либо еще. К предположению Сергея о вентиляционной отдушине у верстальщиков Дон вместо комментария поставил "демонический смех".
  Что-то я просмотрел в этом дурацком пазле, где девятьсот кусочков из тысячи не имеют отношения к картинке. Если бы так не знобило и не болела голова... Ладно, личные контакты с кем бы то ни было откладываются на неопределенный срок, но в моем распоряжении виртуальные источники. Прорва виртуальных источников. Параноидально собираемая информация о всех действиях обитателей сектора С за пару последних недель и еще два раза по два месяца в этом и в прошлом году - во время подготовки первых двух книг. Какой простор для аналитика!
  Он постарался сесть прямо, спиной придавив подушку к стене, и принялся просматривать заказы, которые делали сотрудники, от последних к более давним. Гринуэй: овсянка мгновенного приготовления, таблетки от головной боли и какой-то гептамиксин; яблоки, три штуки; сувенирный флакончик бренди, молотый кофе и сливки, шоколадка, снова яблоки... Мольвиг: вертушка детская из фольги, мороженое, ванильный ароматизатор для кофе, кока-кола, пицца, гептамиксин, молотый кофе, мороженое... Беру свои инсинуации назад: ни капли алкоголя, для полноты картины не хватает только трехдюймового Героя Галактики и упаковки сахарной ваты. Но что такое гептамиксин? Сергей ткнул в загадочное слово искалкой: "Антибиотик, активный в отношении патогенных штаммов кишечной палочки". Ха! Выходит, пострадали не только мы с Доном. И судя по тому, что редактриса и художник сегодня утром выглядели бодро, это именно то, что нам нужно. "Заказать".
  Гептамиксин, как выяснилось, недавно заказывали и верстальщики. Может быть, это и есть коварный замысел "крота"? Заразить всю команду кишечной инфекцией и в это время... что в это время? Даже если предположить, что кто-то бегом убежит от компьютера, оставив открытый текст, каким образом к нему подберется "крот", причем так, чтобы это не отразилось на видеокамерах? Но подумать об этом надо. Проверить, не приходил ли к ним, например, врач...
  Сигнал вифона. Ага, вот чего мне как раз не хватало. Видеосвязь лучше включить сразу и добровольно.
  - Да, мама?
  - Почему ты так выглядишь? Ты заболел?
  По идее, у мамы должно быть мало времени... хотя нет: там у них сейчас день, на конференции обеденный перерыв. Деликатный эвфемизм "легкое расстройство желудка" возымел предсказуемое действие. Пришлось представить отчет по питанию и образу жизни, и только для того, чтобы в итоге услышать неизбежное:
  - Милый, тебе самое время подумать о дальнейшей карьере. А ты вместо этого пьешь по вечерам водку - а пить водку ты не умеешь, вроде твоего отца - и взираешь на луну.
  - С чего ты взяла? - невежливо буркнул Сергей, ощущая, как стремительно молодеет. То есть деградирует и возвращается в отрочество. Мысль о шпионской видеокамере в студии кузена Алекса была абсурдной и вдобавок умножала сущности сверх необходимости. Мамочке не нужна шпионская камера, она и так знает, чем он занят. Без разницы, через две ли стены или через полмира.
  - Х-мпф, тоже мне тайна. Ты после лунного контракта сам не свой, и ничего не рассказал.
  - Я рассказывал весь вечер...
  - Ты пудрил мне мозги весь вечер, - непреклонно ответила мама. - Я не возражала, человек имеет право на личное пространство, но все хорошо в меру. Пора уже заняться собой. Я записываю тебя в группу гештальт-терапии, - она наклонилась над тач-скрином. - Это в твоем квартале, занятия начнутся послезавтра.
  - Мама, у меня расстройство желудка! - взвыл Сергей. - Я туда не дойду, а если дойду, не смогу беседовать дольше пяти минут!
  - За два дня все пройдет, если не валять дурака, а лечиться. Тебе определили возбудителя заболевания?
  - Конечно. (Когда врешь уверенно, это может прокатить.) Да я знаю, где заразился, там вся контора болеет. Я уже заказал себе антибиотики.
  - Он знает, где заразился, - с непередаваемой иронией произнесла мама. - Хороший мальчик. Антибиотики нельзя принимать наугад, ты понимаешь это? Сиквенс тебе делали?
  - Мне?
  - Возбудителю! Полногеномный сиквенс, это уж не так дорого стоит, можешь себе позволить. Тебе рассказать, сколько сейчас новых штаммов? Эти биохулиганы в один прекрасный день доиграются в свои игры, попомни мое слово, получим новую холеру, бубонную чуму. А при нынешних нарушениях санитарных норм... Сережа, тебе плохо? Я говорила, чтобы ты не пил сока!..
  - Мне хорошо, - с тихой радостью ответил Сергей. - Как я не допер - мороженое, вот что мне нужно в первую очередь...
  - Ты хочешь мороженого? Он хочет мороженого! - привычно воззвала мама к невидимым слушателям - должно быть, к предкам, бесчисленным Островским, Коэнам и Маркусам, наблюдающим за судьбой непутевого потомка. - С ума сошел! Не смей, ты меня понял?
  - Ма, не волнуйся. Никакого мороженого, тебе послышалось. И я немедленно сделаю сиквенс.
  - Немедленно? Тебе так плохо?
  - Мама, мне не плохо, просто я подумал, что ты права. Так бывает, честно. Прямо сейчас сделаю, дурак был, что не сделал раньше. И антибиотики пить не буду. И сразу перезвоню тебе, хорошо?
  
  ***
  
  На следующее утро Сергей Островски снова посетил сектор С издательства "Дольфин Букз". Отдав вифон на контроле и ответив на все вопросы, он сразу прошел к Мольвигу.
  - Мистер Островски, - художник церемонно поклонился. - Кофе будете?
  - С удовольствием. А можно, я сам? Предпочитаю пользовательский режим.
  - Тут неудача. Пользовательский режим у меня не работает. Вернее, работает, но как-то странно.
  - А, ну ладно, пустяки. Я, собственно, с личным и несколько деликатным вопросом.
  - Давайте.
  - Вы недавно перенесли желудочное заболевание?
  - Желудочно-кишечное, - любезно улыбаясь, подтвердил Генри Мольвиг. - И не я один, многие пострадали. Кто-то заразный к нам проник, ваша служба плохо сработала.
  - Тут вы попали в точку, - медленно сказал Сергей. И, не дожидаясь приглашения, прошел к кофе-машине. Положил на нее руку, побарабанил пальцами по корпусу. Молча посмотрел на художника.
  - Я ведь тоже подцепил эту инфекцию. И решил сдать анализ, заказал исследование в клинике. Нельзя быть чересчур внимательным, знаете ли.
  В комнате снова воцарилось молчание.
  - И что же показало исследование?
  - Пока результаты только предварительные. Увидим. Удачного дня, мистер Мольвиг.
  Художник медленно опустился на кровать, не сводя глаз с табло кофе-машины. После того, как гость поиграл с кнопками, в окошке времени случайно выставилось "1 ч.". Нелепое время, если думать о приготовлении кофе.
  
  ***
  
  В этот раз Сергей поехал к Дону овервеем. Поездка заняла около сорока минут. Дон теперь выглядел гораздо лучше, и на рабочем столе у него, насколько мог разглядеть Сергей, были те же самые файлы, что и у него вчера.
  - Серж, заходи. Спасибо за подсказку с таблетками, меня наконец-то отпустило.
  - Спасибо скажешь чуть позже, - ответил Сергей. - Или не скажешь, как получится. У меня есть результат.
  - Я весь внимание.
  - Понадобились видеозаписи из комнат сотрудников и списки их заказов.
  - Смотрел я эти видеозаписи, - желчно сказал Дон. - Если бы я так работал и это фиксировалось бы на видео, меня бы вышибли с треском. Половину времени ничего не делают, только бродят туда-сюда, жуют что-нибудь или на кровати валяются.
  - "Хороши писатели. Я минут десять следил за этими писателями - двое совсем ни строчки не написали".
  - Вот-вот, - серьезно кивнул Дон. - Если бы десять, а то гораздо дольше. Особенно Мольвиг.
  - Забавно, что ты о нем вспомнил. Как раз хотел предложить тебе посмотреть записи с его видеокамеры. Не все, а только за те дни, когда он заказывал мороженое. Вот, например, прекрасные кадры.
  Дон напряженно проследил, как долговязый художник с пластиковой коробкой в руке отходит в "кухонный" угол, возится там с кофе-машиной, потом возвращается, неся мороженое на блюдце. Заваливается на кровать. Ест мороженое, что-то просматривая в планшете...
  - И что на этой картинке неправильно? - спросил наконец Дон. - Я уже что-то пропустил?
  - Можно и так сказать. Я, собственно, что имел в виду: когда Мольвигу привозят мороженое - всегда особенные сорта из одного и того же ресторана "Дзанарди", ты заметил? - он включает кофеварку, а кофе не пьет. Не каждый раз. Иногда мороженое - это просто мороженое. Но в этот раз, например...
  - Да ладно, - Дон подхватил пальцем "бегунок" под картинкой, переместил его вперед. - Вот же, смотри: подошел, налил, несет чашечку.
  - Ага. Дай увеличение.
  Чашка и рука выросли, заняли собой весь экран. В коричневой жидкости лопались пузырьки, выбрасывая вверх микроскопические капельки.
  - Что за черт? У него там растворимая таблетка?
  - Это не кофе. У нашего художника прекрасное чувство перспективы - он виртуозно прячет руки от камеры на пару секунд, когда ему нужно. Он там у себя в углу налил в чашку что-то другое. Кока-кола, энергетик... присмотрись, как он отхлебывает. Что бы это ни было, оно холодное.
  - Ты это заметил? - с оттенком профессиональной зависти спросил Дон.
  - Я знал, на что смотреть.
  - Так в чем тут фокус? Наливать кока-колу в кофейную чашку - еще не нарушение правил внутреннего распорядка.
  - Конечно, нет. Нарушение - использовать кофеварку так, как он ее использовал. Если я правильно все понимаю, то ближайшие несколько часов в ней нельзя было варить кофе.
  - И что же кофеварка делала в это время? Вела радиотрансляцию на коротких волнах? Серж, я готов тебе верить, но после лампы, знаешь... хотелось бы дополнительных аргументов.
  - Будут и дополнительные, будут и окончательные. - Сергей подключил вифон к компу и вытащил картинку с буквами H&W в ободке лупы. - Вот. Потратил полдоллара на установку, будешь мне должен. Знакомый софт?
  Дон не удержался от улыбки.
  - "Холмс и Ватсон". Ее еще продают?
  - Ага. Умные дети всегда увлекаются кодированием, что в наше время, что теперь. Хлебом не корми, дай поиграть с программкой-криптографом, написать письмо загадочным кодом, а друг пусть расшифровывает. Главное - ввести туда символы кода и указать, что должно им соответствовать: буквы латинского или другого алфавита, цифры... ну, сам знаешь, да? Пока оставим это и посмотрим другой файл.
  Сергей раскрыл текст, украшенный логотипом с медицинской символикой.
  - Тут последовательности ДНК твоей кишечной палочки... виноват, теперь и моей тоже. Мама вчера заставила меня пойти в круглосуточную клинику, сдать анализ и сделать полногеномный сиквенс, чтобы не лечиться наобум.
  - Мудрая у тебя мама.
  - Ты не представляешь, насколько. Так вот, у бактерии обнаружилась крайне любопытная плазмида - кольцо внехромосомной ДНК. В ней, помимо сигналов о начале копирования, имеется несколько неопровержимых свидетельств ее искусственного происхождения. Например, мотиватор, то есть участок, который препятствует бактерии от нее избавиться, не спрашивай, как именно, в файле все это есть. А иначе несчастная кишечная палочка давно перестала бы ее воспроизводить, поскольку проку ей от этой плазмиды ноль. Большую ее часть занимает протяженный участок, не кодирующий никаких белков. Точнее, главным образом не кодирующий. А еще точнее - не кодирующий ничего, интересного с точки зрения бактерии.
  Сергей перестал трепаться и взглянул на Дона. Тот мрачно молчал.
  - Хорошо. Мы копируем эту последовательность... скажем, ее начало, сразу рядом с ориджином репликации... и тащим вот сюда. - Сергей перенес выделенный фрагмент в H&W, в "записку доктора Мориарти". - А теперь задаем условия расшифровки. Исходными символами у нас будут нуклеотидные триплеты, коих, как известно из школьного курса, всего шестьдесят четыре - четыре в кубе, потому что каждую из трех позиций занимает одна из четырех букв - A, T, G, C. Этого достаточно для кодирования двадцати шести букв английского алфавита, с учетом того, что нужны и прописные, и строчные. Еще остаются двенадцать символов на пробел и знаки препинания, а вот на цифры уже не хватает - приходится изощряться. Но он справился, на квадруплеты переходить не стал... Ладно, запускай расшифровку. Я это уже делал, хочу, чтобы ты тоже получил удовольствие.
  Палец Дона коснулся кнопки. Рядом с "запиской Мориарти", заполненной невразумительными "actgaaatcgatcgatcgtttt", раскрылся "блокнот Шерлока Холмса", а в нем - текст.
  
  еФкт ю!Гчш ?фщ Нельзя быть чересчур внимательным - таково было убеждение Фердинанда. Черная чешуя обгорелого полена в траве, живые зеркальца ивовых листьев, отражающие утреннее солнце, все это...
  
  Несколько секунд Дон смотрел на экран, потрясенно моргая. Потом втянул воздух сквозь зубы и... такие монологи Сергею редко приходилось слышать даже в молодости, в полицейском участке ночью после большого праздника. Неизобретательно, но душевно крыл начальник службы безопасности "Дольфин Букз" всех пиратов и их сухопутных приспешников, и персонально художника-оформителя элитной серии, спятившего от неправедных денег и славы, и чокнутых издателей, и полоумных поклонников Марио Каматы, и безбашенных биотехнологов, торгующих опасной продукцией направо-налево... Здесь он остановился и спросил:
  - Так ты поэтому прицепился к мороженому?
  - Естественно. Синтезатор ДНК он сделал из кофеварки. Дело нехитрое - просто заполнить реагентами сменные пластиковые контейнеры для ароматических добавок. Переделки потребовались минимальные: добавить несколько новых контейнеров с трубочками, немного изменить прошивку. Полагаю, все это было сделано во время работы над первой книгой, когда контроль был менее жестким. Современная кофе-машина достаточно умна, чтобы поддерживать определенные значения температуры и добавлять компоненты в определенном порядке. Обычно она смешивает два-три вещества, ну, скажем, пять, и на этом все кончается, но ничто не мешает ей повторять эту простую операцию сотни тысяч раз, была бы программа. А в качестве программы выступал текст романа. Файл никуда не перекачивали, компьютер кофе-машины просто обращался к нему через внешнюю связь е-книги. Положить переносное устройство для чтения на полочку рядом с кофеваркой - это ведь не нарушение внутреннего распорядка, так?
  Дон только выругался вместо ответа.
  - Ну вот. Оставалась одна проблема: где взять реактивы? Ферменты, нуклеотиды и прочее ему пересылал сообщник в холодном контейнере. Видимо, сигналом был определенный набор сортов мороженого в заказе. Там же была культура бактерии, из тех, что применяют в медицинских целях. Он ее трансформировал своей плазмидой и проглатывал.
  - Как какой-нибудь долбаный Луи Пастер, или кто там привил себе язву желудка.
  - Очень верное сравнение. Да, он рисковый человек, это тебе не йогурту выпить. Помнишь шутку про миллион обезьян, которые миллион лет стучат по клавишам и в конце концов напишут "Войну и мир" не хуже Льва Толстого? Насчет обезьян не знаю, но Марио Камата, как выяснилось, способен породить последовательность букв, которой соответствует активный ген весьма любопытного короткого белка. Спасибо, что это был не токсин шигеллы или, скажем, холерного вибриона.
  - Он еще больший псих, чем я подумал, - яростно прошипел Дон, имея в виду явно не Камату. - Спорим, ему пришьют биотерроризм.
  - Едва ли. Предполагалось, что последовательность ДНК в бактериальной клетке останется инертной - будет копироваться за ее счет, но не кодировать никаких белков. Чтобы ген активировался, перед ним должен стоять промотор - определенные буквы в определенных местах. Наш фигурант, как я понимаю, не ожидал, что это может произойти, он с умом подбирал кодировку. Не только приписывал графически похожим буквам похожие триплеты, чтобы опечатка, буде случится из-за мутации, выглядела как ошибка распознавания, но и постарался исключить некоторые сочетания. В художественных текстах редко попадаются аббревиатуры AC и DY, разделенные ровно шестью символами. Или слово, имеющее в середине либо в конце заглавное О. Или заглавная гласная сразу после маленькой d. Камата, как я понял, не любитель таких экспериментов.
  - Ну, вообще бывает... Обязательно заглавными?
  - Да, я же говорил: кодировка заглавных у него отличается. Но для гения, я имею в виду Камату, нет ничего невозможного. Если ты помнишь, он набрал сплошными заглавными размышления героини в третьей главе. Глянь.
  Дон посмотрел на выделенное красным "HER MANIACAL FERDY" и снова коротко выругался.
  - Не трогай мэтра. Он фактически сорвал преступный замысел. Сама книга сурово отомстила похитителю.
  Дон фыркнул. По лицу его было видно, как ярость уступает место профессиональному подходу.
  - Еще раз: как он это делал?
  - Элементарно. Получал очередной фрагмент книги, копировал его себе в книжку, что было дозволено и предписано. Книжку клал к кофе-машине, то есть реактору, синтезирующему ДНК по заданной последовательности. Сам залегал на свою кушетку с планшетом и рисовал очередную иллюстрацию. Когда приходило время, проглатывал культуру клеток, заедая мороженым, и бактерии у него внутри начинали копировать фрагмент романа со скоростью полтысячи знаков в секунду. А дальше он заходил в любую из ваших уютных туалетных комнат и... э-э... транслировал украденный фрагмент за пределы издательства. Урби эт орби, так сказать. Кроме того, в разносчиков заразы могли превратиться и другие, честные сотрудники, и даже совсем посторонние люди - вот как я, например. Полагаю, первые две части трилогии уже расселились по всей канализации Большого Города. И за его пределами. Это знаешь, так же, как с пиратскими файлами: вылетит - не поймаешь. Не исключено, что в твоих кишках, - Сергей нацелил на Дона палец, - сейчас обитают и первые части, хотя и с купюрами: по моим подсчетам, каждая из книг живет примерно в десятке штаммов.
  - Именно это я чувствую уже много месяцев, - с сердцем произнес Дон. - Ладно, выпустил он этих бактерий, а дальше-то что?
  - А дальше сообщник обращался к данным местной автоматической станции санитарного контроля, которая делает тотальное секвенирование ДНК в пробах из канализационных стоков, и запрашивал совпадения с определенной последовательностью. Эта информация уже не секретная, фекальной микрофлорой может интересоваться любой желающий. Робота-аналитика не привлекали необычные участки ДНК, коль скоро они не содержали потенциальных регуляторных элементов. А когда привлекли - ну, прошло в санитарном бюллетене сообщение, что на Манхэттене появился новый штамм кишечной палочки, способный вызывать не опасную для жизни диарею, так это случается каждую неделю. Тесно живем, слишком много человек на квадратную милю.
  - Так откуда произошла диарея?
  -Я к этому веду. Мольвигу просто не повезло: в перекодировке фраза о чокнутом Ферди дала сочетания букв "tttaca... tatgtt" на нужном расстоянии друг от друга. Этого оказалось достаточно, чтобы получился сносный промотор - и начался синтез матричной РНК. А на ней, в силу еще ряда совпадений, синтезировался короткий белок, активный в отношении слизистой кишечника. Бактерия, так сказать, предложила свою трактовку потока сознания героини. Но поскольку она абсолютно лишена интеллекта и эстетического вкуса, да и вообще читала на другом языке, на выходе оказался банальный понос.
  Дон засмеялся, но тут же оборвал смех.
  - Серж, я тебе обязан по гроб жизни. Считай за мной долг. Но еще одна просьба: никому ни слова обо всем этом. Если станет известно, что "Дольфин Букз" трилогию Каматы в буквальном смысле про... ну ты понимаешь... это будет очень плохой пиар. И для издательства, и для Каматы. В своем роде это не лучше, чем потерять текст. Господи, еще хуже! Извини...
  - Что, опять?
  - Иди нафиг. Хочу позвонить. Я должен быть уверен, что этот гад не ускользнет.
  - Мольвиг? - Сергей развалился в кресле, вытянув ноги. - Но куда он денется? Он же не должен покидать здание до завершения проекта, я правильно понял?
  - За исключением обстоятельств, особо упомянутых в соответствующем пункте контракта! - Сухая формулировка прозвучала необыкновенно хищно. Дон протянул руку, и сигнал вифона опередил его. Показав рукой Сергею: мол, уберись из зоны видимости, но не уходи, - Дон нажал кнопку приема.
  - Сэр, тут у меня Генри Мольвиг. - На экране появился молодой человек в штатском, тот самый, что впускал Сергея в первый день. - Он говорит, что хочет экстренно разорвать контракт по личным обстоятельствам. Я сказал ему, что должен сообщить вам, согласно инструк...
  - Уилли, не выпускай его ни в коем случае!
  Вопль начальства заставил Уилли выскочить из кресла.
  - Да, сэр, мы условились, что он подождет. (Парень повернулся вправо, ища глазами кого-то, и замер с приоткрытым ртом.) Мистер Мольвиг? Минутку, сэр, он, наверное, вышел...
  - Твою мать!!!
  ...Через четверть часа Дон, весь красный, оборвал связь и оглянулся. Сергей добросовестно сливался с интерьером - играл в какую-то игру на своем вифоне, воткнув наушники и всем своим видом показывая, что внутренние дела службы безопасности его не касаются.
  - Ты предупредил его.
  - Что? - Сергей вытащил затычку из уха.
  - Пока Уилли звонил мне, ублюдок вышел из нашего офиса и направился к лифту на служебную посадочную площадку. Похоже, взял у кого-то со стола ключ-карту, когда узнаю, у кого - оторву голову раздолбаю. Оттуда его, очевидно, в ту же секунду забрал коптер, потому что на площадке его не было. Бежать за тем мороженщиком, насколько я понимаю, поздно, хотя я и озадачил ребят. Мороженое возил курьер из "Дзанарди", всегда один и тот же, - студент медицинского колледжа. И коптер никто не видел, черт, черт, черт... Это ты его предупредил.
  - Дон! - укоризненно воскликнул Сергей. - Возможно, я был сегодня утром несколько неосторожен. Понятия не имею, где я прокололся, но... да, наверное, он что-то понял.
  - И разумеется, ты этого не хотел!
  - Разумеется. Но утечка прекращена. Он ведь не успел получить четвертую главу и далее? А публичный судебный процесс против известного художника не добавил бы издательству шарма. И откровенно говоря, я тоже подумал, что этой унитазно-литературной истории не нужна огласка.
  - Что?! Да теперь об этом будут кричать все пиратские форумы!
  - А "Дольфин Букз" ответит, что это гнусная ложь, недостойная внимания. Одно дело заявление обвиняемого на открытом процессе, другое - брехня в форумах. Но едва ли до этого дойдет: такой хороший метод где-нибудь сработает еще раз, если болтать о нем поменьше. Мысли позитивно: может, в другой раз это случится с другим издательством.
  - Ты ни хрена не изменился с академии. - Дон подошел к бару и вдумчиво оглядел три пузатых бутылки.
  - Такой же многообещающий юный курсант?
  - Такая же самодовольная сволочная зараза. Хочешь пиццу-маргариту?
  Сергей подался вперед, блеснул глазами.
  - Отдай половину, и можешь сказать мне еще четыре плохих слова по твоему выбору.
  
  
  Виски на голодный желудок производит удивительное действие. Веселящее главным образом, но также что-то случается с интенсивностью света и силой тяготения.
  - За литературу!
  - За литературу. Как этим проклятым тварям покажется алкоголь?
  - Тем, что выжили после гептамиксина? Наверное, понравится. А тебе разве не нужно работать? Докладывать начальству, директорату, все такое?
  - Сейчас выпьем еще, и я им напишу. А вообще я увольняюсь, как только сдам отчет. Хватит с меня. Кстати, ты, надеюсь, понимаешь, что издательство предъявит твоему протеже иск о возмещении убытков?
  - Что ж, полагаю, недвижимость в этой стране ему больше не понадобится. А в качестве капитала у него останется имя. Завтра более громкое, чем вчера.
  - Чего не хватало этому старому идиоту? - простонал Дон.
  - Это был вопрос? - невинно уточнил Сергей. - О мотивах преступления?
  - А что, ты и это успел узнать?
  - Только гипотеза. Ничего такого, чего не было в его досье. Помнишь, лет двадцать назад он участвовал в инциденте, связанном с правами на интеллектуальную собственность? Когда был художником мультсериала "Форкосиганы".
  - Инцидент... а, рисунки на стенах кафе в кампусе Херберт-колледжа? Помню, конечно: нарисовал нескольких персонажей да еще и подписался, безумец. Но это же ерунда, с кем из них не случается. Ему, кажется, ничего за это и не было.
  - Можно сказать, что ничего. Студия повела себя великодушно, они были в нем заинтересованы. Стену покрасили, виновные отделались штрафами, инцидент предали забвению. Все, но, возможно, не он. Я обратил внимание на некоторые его картины того периода, те, что выставлялись, они тоже есть в досье. "Долли с черной кошкой", "Долорес", "Д.Г. и три апельсина"...
  Дон недоуменно свел брови, потом сунулся в файлы.
  - Бинго! Не ищи, я тебе сам скажу: владелицу кафешки звали Долорес Гилл. Кстати, Мольвиг ни разу не был женат, верно?
  - Ну, это уже твои фантазии.
  - Гипотезы. Но если они верны, то закон о защите интеллектуальной собственности сильно подпортил его жизненные планы.
  - Экие нежности, - буркнул Дон. - Преступление - в любом случае преступление, не согласен? Ничего, что этот артист намеревался отнять деньги - не у издательства или Каматы, нет! - а у сотен сотрудников издательства, у конкретных людей? Отнять шанс у молодых писателей, чьим агентам "Дольфин" отказал бы? Когда прибыли мало, не до новых проектов.
  - Ты прав. Просто, понимаешь... я сам в школе смотрел "Форкосиганов". Естественно, не знал имени художника до вчерашнего дня. Но меня бы не обрадовал его арест.
  - Б-благотворитель. - Дон произнес это, словно еще одно плохое слово. - Куда он двинет теперь, как ты думаешь?
  - Выбор большой. Латинская Америка, Африка южнее Сахары, острова. Многих художников на определенном этапе развития манят экзотические страны, вспомни Гогена. И, может быть, ему хочется снова порисовать на стенах и заборах.
  - Как будто ему кто-то мешал делать это здесь! Заключай контракт либо подписывай отказы - и рисуй себе.
  Сергей откинулся в кресле, взглянул в окно, на летнее небо с разноцветными блестками "летучих такси". Потом неуверенно предположил:
  - Может, его что-то не устраивало в этой схеме.
  
  
  
  Дело об откушенном пальце
  
  - Вот тут это произошло, сэр. Я был у себя в кабинете, за той дверью, услышал стон, выбежал, сразу набрал девять-один-один... Я вам говорю, он это сделал нарочно! Ладно, он не специалист по пластикам, но ведь он инженер, так? Как вы считаете, мистер Островски, инженер должен понимать, что расплавленный поликарбонат - это не гель для рук, или не должен?!.. Прошу, вот сюда.
  Клиент моложе меня, подумал Сергей. Существенно моложе. Ивен Стрингер, руководитель и директор по науке Repeat&Return Ltd. (компания состояла из трех человек, включая Ивена), был похож на капитана школьной спортивной команды. Причем этой команде только что коварно и незаслуженно присудили поражение. Высокий, кудрявый, с мальчишеским румяным лицом, на котором написано: "ТАК НЕЧЕСТНО!"
  - Из общих соображений должен, - осторожно согласился детектив Островски, - но частные случаи бывают разные. Я встречал людей, которые годами водили машину или ховеркрафт, при этом не имели водительских прав и не знали элементарных вещей. Понимаете, ничего сверх того, что нужно, чтобы ехать прямо, вправо и влево... (Ивен выпятил губу, показывая, что пример его не убедил.) Хорошо, давайте я перескажу, что понял из вашего письма, а вы меня поправите, если заметите неточность.
  Ивен кивнул.
  - В апреле к вам обратился некий Крис Новак с просьбой распечатать объект... что это было?
  - Защитные очки.
  - Очки, так. Он дал вам свой файл, вы проверили его и запустили печать. Он сразу сказал вам, что хочет наблюдать за процессом?
  - Нет, этого он не говорил. Просто отказался пройти в холл, я не настаивал... если бы я знал, сам бы его отвел за руку, но откуда мне было знать?! Многие просятся понаблюдать. Людям это нравится.
  - Я понял. Значит, он остался там, у принтера, а вы вернулись в кабинет.
  - Так. А потом... давайте я вам покажу запись с камеры.
  Ивен поднял экран и сделал приглашающий жест.
  Сергей увидел 3D-принтер, мимо которого они только что прошли, еще не заключенный в прозрачный короб. Рядом на высоком табурете сидим человек средних лет и заурядного вида. Головка принтера мечется туда-сюда, стремительно, плавно и точно укладывает тончайшую пластиковую паутинку в нужные места; зрелище в самом деле завораживает, как движения рук крупье или мельтешение пчел у летка. На подсвеченной подложке становятся ярче и ярче две блестящие полоски, надо полагать, основания стекол очков. Человек на табурете нахмурил брови, склонился вперед, что-то выглядывая. Прошло секунд тридцать, прежде чем он придержал одной рукой головку принтера и сунул указательный палец другой в зону печати. ("Видели?!" - прошептал Ивен.) Рычаг вырвался из руки, и в следующих кадрах было прекрасно видно, как паутинки снова и снова пересекают палец, и прозрачное кольцо на пальце становится багрово-черным. Сергей, не удержавшись, выругался, Ивен хмыкнул - как человек, который показывает приятелю любимый фильм и радуется, что тот оценил самый классный момент. Лицо Криса Новака еще секунду-две оставалось спокойным, а потом он отдернул руку, страшно скривился и застонал. Картинка замерла.
  - Да. Впечатляет, - признался Сергей. - Я не инженер, но я не стал бы совать туда палец. Честно скажу, я и стило от вифона не стал бы туда совать. Он как-то объяснял свои действия?
  - Просто отлично объяснил. Сказал, что хотел что-то поправить в модели! Думал, что пластик только теплый... Вот скажите, как можно было такое думать, если изделия используют в интервале до ста двадцати пяти по Цельсию?!
  Сергей пожал плечами. Еще в полицейском управлении он убедился, что люди совершают необычные и труднообъяснимые действия куда чаще, чем можно подумать, а год с лицензией частного детектива подкрепил это наблюдение яркими примерами. Один человек внезапно являет хитрость, которой от него никак не ожидаешь, другой - феноменальную тупость. Ты с ума сходишь, просчитывая его мотивы и возможности, а он просто идиот...
  - И заметьте еще вот что. Если бы вы хотели поправить какую-то мелкую деталь, какой рукой бы вы это делали?
  - Хм... да, верно. Он не левша?
  - Он не левша. Он сволочь! Через неделю он снова пришел. Тычет мне в нос свою руку в стерильной перчатке, требует компенсации за увечье. У нас не огорожена опасная техника, не вывешены предупреждения... Я сказал ему, что не собираюсь идти у него на поводу, потому что его требования необоснованны.
  -Так и сказали? - с любопытством спросил Сергей. Румяные щеки Ивена еще сильнее порозовели.
  - Ну, общий смысл был такой. Конечно, мне не стоило упоминать Дарвиновскую премию... Короче, он ушел, а через день я получил письмо от его адвоката.
  - Он хочет получить компенсацию через суд? Много?
  - Сто тысяч.
  - Да, это скорее премия Стеллы.*
  
  *________
  Дарвиновская премия присуждается с 80-х годов ХХ века за самый глупый способ умереть или лишиться репродуктивных способностей. Премия Стеллы вручалась в начале XXI века за самые нелепые судебные решения на территории США; названа по имени женщины, которая отсудила крупную сумму у сети ресторанов после того, как пролила на себя кофе и получила серьезные ожоги.
  
  - Что?
  - Нет, извините, это я о своем. Продолжайте, пожалуйста.
  - Ну хорошо, компенсация, в этом есть смысл. Мы виноваты. Учитель физики у нас в колледже всегда говорил: рассчитывай на максимальную глупость. Но про эту историю появилась новость, сначала на городском портале, потом пошло шире... Все, кому не лень, пишут про Новака и Стрингера. Количество заказов упало втрое. Позавчера меня в баре спросили, зачем я откусил клиенту палец.
  - И что вы ответили?
  - А-а... Вы не шутите, мистер Островски. Это то, зачем я вас пригласил. Докажите, что он специально причинил себе увечье.
  - Это будет непросто, мистер Стрингер. При всем уважении, ваш учитель прав: если дурак покалечился, виноват тот, кто не присмотрел за дураком.
  - Но он не дурак! Неужели вы не видите?! Он знал, что случится, и сам этого хотел!
  - Допустим. У вас есть предположения о мотивах?
  - Деньги, - сказал Ивен. - Решил получить с нас компенсацию.
  - И потратить ее на протез, - задумчиво договорил Сергей. - Я посмотрел, пока ехал, - полнофункциональный тактильный протез примерно во столько ему и обойдется.
  - Он может выбрать эконом-вариант.
  - Вряд ли. Ему нужны обе руки, он работает с электрическими схемами, вручную что-то такое делает. Хотя рука и левая, как минимум тактильная чувствительность нужна...
  Если только он не надумал сменить профессию, тогда ампутация пальца - хорошая причина, а компенсация может быть использована для старта в новом направлении. Запомним версию, а пока продолжим разбираться с предыдущей.
  - Как вы полагаете, у него не было причин вас ненавидеть? Может, его интерес не в том, чтобы деньги были у него, а в том, чтоб у вас их не было?
  - Денег и репутации, - уточнил Ивен. - Похоже на правду. Но что мы ему сделали?!
  - Я первый спросил. Никаких предположений?
  - Ну-у... Есть холивар между нашими и стариками. Они считают, мы занижаем стандарты, лепим дерьмо из дерьма, отбираем у них хлеб, само собой. Типа, из-за нас люди забудут, что такое настоящее качество, не будут знать цены хорошим вещам.
  - А это не так?
  - Это - не так, - с нажимом произнес Ивен. - Они непоследовательны и нелогичны. Или мы лепим дерьмо, или мы отбираем у них хлеб, верно?
  - В общем, да. А какое из двух "или"...
  - Вот, посмотрите! - Ивен взял со стола и протянул Сергею миниатюрную статуэтку высотой в два сустава мизинца.
  - Нэцкэ?
  - Окимоно, - поправил Ивен. - Нэцкэ с отверстием, их носили как подвески. Вот честно, мистер Островски, если бы ее дал вам не я, вы догадались бы, что это три-дэ-печать?!
  Сергей повертел фигурку в пальцах, поднял к глазам. Полированная кость - как будто настоящая, и вес правильный, и упрямая живая прохлада. Сначала кажется, что это стройная молодая женщина присела и наклонилась вперед, во что-то вглядываясь, потом видишь морщины у растянутого рта, жилистую руку, худые, обезьяньи ступни. Жидкие пряди волос, узоры на отворотах кимоно намечены тончайшими волосяными линиями, и даже видно, что одежда на плече разорвана.
  - Нет, не догадался бы, - признал он. - Разрешение, конечно, потрясает.
  - Тут многое зависит от сканирования, - с напускной скромностью сказал Ивен. - Японцы выкладывают очень качественные файлы. На подошве, естественно, маркер, - видите углубление? Так хитро сделано, что убрать его из файла нельзя. Да и зачем? Вещи известные, место их пребывания известно, это все равно что распечатать Мону Лизу. Но можем мы все. (Это прозвучало не то чтобы гордо, но уверенной такой констатацией... Вишну, Брахма, Ивен Стрингер.) Или почти все. У нас самый широкий спектр услуг в городе. Конфетки и пластиковые игрушки печатают многие, это неинтересно.
  - Мону Лизу... Хорошо, мистер Стрингер, с Моной Лизой пусть разбираются искусствоведы, а теперь скажите мне вот что. Если я захочу, чтобы вы распечатали для меня... допустим, копию моего вифона, сможете ли вы это сделать и что на это скажет производитель?
  - Можно взглянуть, какой у вас?.. Ага. На самом деле это девяносто процентов заказов. Человек доволен своим устройством, он не хочет привыкать к новой модели, он хочет точно такое же, как у него было. Если производитель выкладывает файлы, нет проблем: я печатаю клиенту новый вифон, и часть оплаты уходит правообладателю. Ваш могу напечатать, в "Тайчи" ребята не жадные, все доступно, кроме брендовых новинок. Напечатаю корпус с экраном, всю механику, естественно, межсоединения. Это, кстати, посложнее, чем окимоно, внутренние структуры, множество разных материалов. Но чипы придется приобретать отдельно, у меня не то разрешение, тут нужен молекулярный принтер.
  - И такие бывают?
  - Бывают, но это уже не совсем принтеры. Короче, напечатать могу, хотя и не весь. Но и ломается чаще всего корпус, экран, аккумулятор - вы не представляете, что люди делают с вифонами. Конечно, на корпусе будет пометка, что это не оригинальное устройство, а три-дэ-копия. Считается, что такие устройства менее надежны, но... - Ивен важно покачал головой, - это городская легенда. Они так же надежны.
  - Я понял. А если файлы именно для этого устройства не выложены?
  - Тогда нет. У меня ограниченная лицензия на сканирование: только простые объекты - мелкие бытовые предметы, одежда. На одежду много заказов, это тоже задача - принесут рваный свитер, приходится после сканирования редактировать файл... Так вот, одежда, всякая посуда, но не электроника, не спинтроника, не произведения искусства, имеющие высокую художественную ценность, бренды и франшизу обычно нельзя. Разумеется, нельзя сканировать и печатать никакое оружие или детали к нему... на самом деле я обвешан запретами, как рождественская елка, иногда удивляюсь, почему еще что-то можно.
  Парень занервничал? Рассказывает больше, чем его спросили, - так болтают, когда хотят, чтобы не спросили о чем-то конкретном...
  - Но вы говорили, что Новак пришел со своим файлом.
  - У него были очки, простой объект. Мог бы прийти с очками, я бы отсканировал и распечатал копию, разницы нет.
  - А если клиент приносит файлы электронного устройства?
  - Он либо показывает, где скачал, либо подтверждает свое право на использование этих данных... Э, а почему вы спрашиваете? Это имеет отношение к делу? Мы не нарушаем копирайт, если вас это интересует!
  - Конечно, не имеет. Я просто хотел кое-что уяснить для себя. Извините за дурацкие вопросы, я не очень разбираюсь в вашем бизнесе.
  - Ничего, - сказал Ивен. - Я тоже погорячился. Вы возьметесь за это дело?
  - Возьмусь, - Сергей протянул ему руку. - Напечатайте мне что-нибудь на память, мистер Стрингер, и я пойду работать.
  - Что-нибудь на память... Пэм! Распечатаешь бантик для мистера Островски?
  - Запускаю!
  - Пойдемте, - Ивен вскочил из кресла.- Пока подойдем к устройству, будет готово. Хочу, чтобы вы увидели его там, а то многие отказываются верить.
  Пэм, согласно бэджу - ведущий инженер, была еще моложе, чем ее шеф. Лопоухая девочка из тех, что имеют привычку сидеть на столах и корчить рожицы, в юбке поверх штанов и с кожаными браслетами на обеих руках. А на шее - колье из серебряных молекул-мономеров, соединенных гибкими связями. Принтер трудился над открыткой, украшенной блестящей ленточкой.
  - Прошу!
  Открытка "Привет из Нотвилла" была еще теплой. Бантик медленно расправлялся.
  - Потяните за кончик ленты, - подсказал Ивен.
  Бант развязался. В тех местах, где был узел, сохранялись складки, но лента была абсолютно ровной. Будто из ткацкого станка или где их там делает.
  - Как вам это? - Пэм сделала бровки домиком.
  - Невозможно поверить. В самом деле, потрясающе.
  Пэм изобразила гордый реверанс, и директор R&R наконец-то улыбнулся.
  - Вы любите свою работу? Все это сканирование, три-дэ-печать?
  - Любим? - Ивен переглянулся с девушкой, как переглядываются родители, услышав детский вопрос. - Мистер Островски, мы, когда начинали, воровали мешки из мусорных контейнеров.
  - Зачем?
  - Не хватало средств на расходные материалы. Вручную сортировали пластик, измельчали шредером и сами тянули нити для принтера. Вообще-то продажные нити делаются точно так же, но все равно мы это не афишировали. Теперь покупаем, конечно.
  - Покупали, - вполголоса уточнила девица.
  - Пэм!
  - И, да, если придется, опять будем воровать мусор! Нас не прикончат! - Пэм подтверждала свои тезисы кивками и ударами кулачка по коленке. Ивен только вздохнул.
  
  ***
  
  Врача скорой помощи Дебору Уильямс рассмешило предложение пообедать с частным детективом в обмен на информацию. Была она по-докторски снисходительна и сразу предупредила, чтобы он и не думал задавать вопросы, нарушающие права пациента. Леди без возраста, гладкое смуглое лицо без косметики, гладкая волна серебристых волос, ироническая усмешка на полных губах.
  - Вас не удивил этот случай?
  - Меня?.. Дорогой мистер Островски, этот случай далеко не самый идиотский в моей практике.
  - В самом деле?
  - В самом деле. Человек сунул палец в рабочую зону принтера, о Господи!.. Второе место в моей коллекции поводов к вызову - "дразнил бультерьера пенисом"... Нет ничего смешного, мы еле спасли его.
  - А кто на первом месте? Хотя нет, уже не уверен, что мне надо это знать.
  - В любом случае я бы не сказала. Женская солидарность.
  - Я понял... Так возвращаясь к Новаку. У вас осталась запись с видеоочков?
  - Да, конечно.
  - Вы могли бы мне ее показать?
  - Прямо сейчас?..
  - Если можно. Я хотел бы просто посмотреть.
  - Не вижу причин говорить "нет", но придется подождать. Записи в нашей базе, я сделаю запрос.
  В базу пускали по отпечатку пальца: Дебора положила подушечку указательного на "глаз" своего вифона и запустила сканирование. Потом попросила Сергея отвернуться, чтобы она могла ввести код. Наконец ролик загрузился, Сергей пересел на ее сторону, чтобы смотреть вместе с ней.
  В первых кадрах не было ничего особенного. Здравствуйте, где пострадавший, все будет в порядке, мистер Новак, дайте руку...
  - Постойте, доктор. Можно здесь дать увеличение? Назад на пять секунд, где его ладонь, и как можно крупнее.
  - Что, вот так? - экран стал телесно-розовым.
  - Да, большое спасибо, - невозмутимо сказал Сергей и начал двигать изображение. - Ага. Что вот это, по-вашему?
  - След инъекции... - в голосе Деборы впервые послышалась неуверенность.
  - А вот еще один. Вы делали ему укол?
  - Нет. - Она обернулась к Сергею, вскинула круто загнутые ресницы, и он сообразил, что доктору нет и тридцати. Старше ее делали серебристая краска для волос и духи-унисекс. - То есть делала, но позже, это - первичный осмотр... Кто-то ввел ему обезболивающее до того, как я приехала? Они не сказали.
  - Эта версия напрашивается, но никто не вводил ему обезболивающее. И сам он себе ничего не вводил, с ним все время была сотрудница фирмы, и видеозапись с камер есть. Она дала ему две капсулы стоп-эйча, и это вся медицинская помощь, которую он получил до вашего приезда. Значит?..
  - Значит, это было сделано еще раньше? До того как он...
  Сергей кивнул.
  - Ваш пациент с бультерьером был таким же предусмотрительным?
  - Тот не был. Но вообще пациенты со склонностью к самоповреждению бывали.
  - Со склонностью? Вы хотите сказать, им это нравится? А тогда зачем он делал себе уколы?
  - Некоторых привлекает... м-м... не боль, а сам факт увечья. - Дебора по-кошачьи сморщила нос. - Это надо корректировать, иначе в следующий раз может быть и не палец.
  - У него в медицинской карте было что-то о самоповреждениях?
  - Нет, не было. Я бы заметила, эту информацию выделяют.
  - А скажите, Дебора, нормально ли для такого пациента потом требовать денежной компенсации с владельца принтера?
  Прежде чем ответить, Дебора закрыла окошко с видео и по-девчоночьи подперла щеку кулаком.
  - Вполне! Нам выдвигают претензии самоубийцы, которых мы спасаем, родственники самоубийц, которых мы не спасаем... Что может быть нормальнее, чем требовать компенсации?
  
  ***
  
  Сетевой поиск не показывал, что Крис Новак - сумасшедший. И что он планировал сменить специальность, тоже ниоткуда не следовало. В Сети Новак рассуждал о микросхемах, транзисторах и конденсаторах, о выходах, каскадах, ширине импульсов... - в общем, более 95% всего, что он писал, было про это. Новак руководил сообществом, в котором все это обсуждалось, участвовал в трех других таких же и в них тоже имел высокий рейтинг. Сообщества были довольно-таки герметичными - не потому, что туда кого-то не пускали, наоборот, читать можно было все, регистрацию требовали только для скачивания файлов (например, если кому-то позарез нужна схема печатной платы ХХ века). Проблема была в другом: вся эта открытая информация предназначалась для посвященных. Детектив Островски понимал очень приблизительно, чего хотят эти люди друг от друга, о чем спорят и чему радуются. Зато было понятно, что Новака в этих кругах уважают: ссылаются на его посты и комменты, вызывают его в треды, чтобы рассудил, причем его ответ как минимум в трех случаях закрыл продолжительную дискуссию.
  Сергей думал, что все эти электрические схемы для устройств, которые должны делать то-то и то-то, давно рассчитывают и рисуют компьютерные программы без участия человека. Оказалось, нет: это профессия, и престижная, нечто среднее между логической игрой и прикладным искусством, но, в отличие от того и другого, хорошо оплачиваемая.
  Тут обсуждали не только схемы, заставляющие мигать светодиоды, но и, например, инфразвуковую пушку, глушилку для телефонной связи, электрошокер якобы для отпугивания собак или устройство для отключения видеокамер. Кто бы сомневался - чисто академически обсуждали, как интересные задачи... Кстати, и мигание светодиодов - развлечение не всегда невинное. Новак в этих темах не комментировал, а одну, про электрошокер, прекратил своей модераторской властью за несоблюдение правил сообщества. Однако это ничего не значило: кто же болтает о деле у всех на виду?
  Не удалось найти никаких признаков того, что Новак кому-то завидовал или кого-то ненавидел. Недолюбливал, пожалуй, дураков. Со случайными людьми, требовавшими объяснить очевидные, по меркам сообщества, вещи, модератор Новак расправлялся круто. Интереса к 3D-печати он тоже не проявлял, не высказывался ни за, ни против. За неделю до инцидента интересовался, где можно распечатать защитные очки для сварочных работ, и ему тут же подкинули адрес R&R.
  После инцидента Крис Новак вышел в открытую сеть один раз. В кратких словах (понятно, одной правой набирать неудобно) передал модераторство и написал, что едет лечиться. Его проводили добрыми пожеланиями, через некоторое время в разделе для праздной болтовни возникло обсуждение случая с откушенным пальцем, вскоре прекращенное как бессодержательное. Один из участников практически слово в слово повторил Ивена, насчет того, что только идиот мог сунуть руку в зону печати. Друзья Новака защищали его и ругали R&R, упирая на то, что "мы не все знаем" и "блогеры всегда врут". Похоже, тут мало кто был знаком с Новаком по реалу. Но один такой нашелся.
  
  ***
  
  Никогда ничего не выбрасывайте. Устройство было похоже на голову Чужого: круглое, серо-серебристое, два динамика как фасетчатые глаза, прямоугольный ротик и откидная крышка черепа, скрывающая затейливую механику. Насколько Сергей понимал, оно предназначалось для воспроизведения звуковых файлов с давно вымерших носителей, а также для приема радиопередач. Квартирный хозяин на его вопрос беспечно ответил, что эта штуковина ему не нужна, и если жильцу она мешает, то он может без колебаний отнести ее в контейнер для техномусора.
  Роберт Эмери, также известный как rem_rem, оказывал услуги по ремонту устаревшей техники. Когда Сергей предъявил ему голову Чужого, глаза у Роберта полыхнули так кровожадно, будто все его предки воевали на окраинах обитаемой Вселенной. Сергей поинтересовался, нельзя ли оживить эту рухлядь хотя бы частично, чтобы она работала в режиме радио на удивление друзьям и девушкам. Дальше говорил Роберт, Сергей слушал и старался делать понимающий вид. Через четверть часа рассуждений об элементной базе и прочих загадочных предметах он спросил, во что это обойдется, непритворно удивился, покачал головой, вник в стоимость антикварных комплектующих... Знаете, мистер Эмери, я подумал, что будет лучше, если я подарю ее вам. Нет, серьезно, для меня это баловство, а вы, я вижу, хорошо в них разбираетесь. Да что вы, не стоит. Пива? Пива можно.
  Дальнейшая беседа протекала в пивном баре - может быть, в том самом, куда Роберт ходил с Новаком. Роберт взял к пиву сэндвич с тунцом, обозначенный в меню как "правда очень большой", и сразу вцепился в него зубами, не прекращая говорить и рассыпая хрусткие крошки - по-видимому, это был его поздний обед. Сергей заказал себе такой же, но обычного размера.
  Заведение было антуражным. В полумраке вспыхивали разноцветные лампочки; по углам что-то попискивало, электронные дудки дудели примитивные мелодии, а порой слышались совсем чудные звуки - щелчки, жужжание, треск и металлический шорох, будто кто-то надраивал зубной щеткой дуршлаг для спагетти. Стены украшали пластиковые панельки с блестящими техноузорами. От "печатных плат" (это они и были) перешли к 3D-печати и к случаю с Новаком. Роберт явно гордился своим знакомством со старожилом форума и сам рассказал, в какую клинику тот лег на протезирование - почему-то в Сан-Диего.
  - ...Конечно, понимал, что пластик горячий, кто же этого не понимает, но... я думаю, это вроде невроза. Он много работал, в таком состоянии иногда находит.
  - Вроде невроза?
  - Ну да. Когда знаешь, что нельзя, а тянет сделать это. Дотронуться до проволоки красного каления, до бегущего шкива, все такое. Нервное явление. Я считаю, Крис абсолютно прав: они должны были поставить нормальное ограждение.
  - А хозяина этой три-дэ-мастерской ты знаешь?
  - Не то чтобы знаю. Он тусовался на "Эмаунт Энджин", это рынок старых деталей.
  - Что-то продавал? - Сергей почувствовал, как фрагменты начинают складываться.
  - М-м, не помню. Нет, скорее что-то покупал. А в чем дело?
  - Ничего особенного, просто удивился. Где три-дэ-печать, и где антикварные детали. (Он уже успел заметить, что лучше говорить "антикварные", а не "старые".)
  - А куда же они без нас. Знаешь, когда говорят, что на принтере можно напечатать все, это значит "все, кроме действительно нужных вещей". Пустой корпус они могут напечатать.
  - Но я так понял, у них проблемы с разрешением, они микрочипы не могут, верно? А ведь в старых приборах все было крупное.
  - Им от этого не легче. Вакуум не напечатаешь.
  - Вакуум?
  - В лампе.
  - В лампе, ага, согласен. - Сергей покосился на старинную желтую лампу, скрытую железной заслонкой в круглых отверстиях, подставил ладонь под теплые световые горошины. Роберт продолжал перечислять, чего еще нельзя напечатать на 3D-принтере, но он уже не слушал.
  Допустим, так: Ивен печатает корпус к какому-нибудь патефону несказанной ценности, покупает к нему начинку, потом продает Новаку как оригинальное изделие. Новак перепродает патефон какому-нибудь коллекционеру, тот узнает про подделку и очень огорчается. Среди преступников попадаются эстеты, а среди эстетов - темпераментные люди с большими возможностями, и можно представить ситуацию, когда палец - приемлемая цена за ошибку...
  - А Новак тоже увлекался антиквариатом?
  - Новак? Нет, он - нет. Он был весь в своих разработках.
  - Ну да, ведь это дорогое хобби, как я понял, - небрежно сказал Сергей.
  - Дорогое?! Серж, да ты что! С деньгами у Криса никогда не было проблем, он бог схемотехники! Он работает на этих... ты знаешь, которые нефть качают из канадских песков, что-то ставит им на трубы, представляешь, как они платят? Но винтаж, хай-энд - не его, ему это не интересно. Понимаешь, это надо любить, или нет смысла...
  Ну, это мы еще проверим. Должно быть что-то. Нельзя идти против адвокатов с двумя розовыми точками на ладони у их клиента.
  
  ***
  
  В лентах комментариев новостных изданий дело об откушенном пальце обсуждалось активно, анализ занял у Сергея полночи и все утро. Но жемчужное зерно удалось найти. Ник Robin Goodfellow оставил, например, такие комментарии:
  Только мне кажется, что все здесь решили придерживаться одной версии - "плохой Стрингер, хороший несчастный Новак"?
  Действия Новака слишком глупы, чтобы быть случайными.
  Я не буду выкладывать доказательства здесь.
  Может, и обычный безумный конспиролог, но проверить стоило. Вычислить, кто такой Добрый Малый Робин и где с ним можно встретиться, оказалось несложным, он практически не шифровался. Точнее, она.
  
  ***
  
  Маленькая кофейня на Четвертой. Двое-трое посетителей, стандартный интерьер в коричневых тонах, воздух такой, что его можно раскладывать по чашкам вместо пенки (почему сам кофе не пахнет так замечательно?). Она была здесь. В таком возрасте нет смысла врать, указывая в профайле любимое заведение.
  Доброго Малого Робина в реале звали Клэр Томсон, и было ей восемьдесят четыре года. Миссис Томсон походила на старого римлянина. Или на жителя планеты Вулкан из саги "Звездный путь": короткая седая челка над черными бровями, желтовато-смуглый тон кожи, выражение лица угрюмое. Она заботливо прислоняла свою трость к соседнему креслу: зацепила набалдашником за подлокотник, приподняла руку на полдюйма, усомнилась, не упадет ли трость, поправила, добиваясь максимальной устойчивости. Вытащила из сумки старомодный маленький вифон, стала что-то просматривать.
  Где эта старуха и где инженеры, Островски? Никаких пересечений - она в прошлом театральный критик, отсюда шекспировский ник. Жена режиссера, знаменитого в свое время (еще до рождения Сергея Островски) - тому вообще лет сто. В конце концов, мало ли психов и странных шутников оставляет многозначительные комментарии к новостям... Ладно, что толку гадать.
  - Извините за беспокойство, вы не могли бы объяснить, как отсюда пройти к центру?
  - К центру? - голос у нее был звучный и неожиданно низкий.
  - На Маркет-сквер, мне надо там встретиться с друзьями.
  Поднялись тяжелые веки, темные глаза строго уставились на него.
  - Вы можете сразу сказать, что вам от меня нужно. Это сбережет вам время.
  Старческая рука с массивным серебряным перстнем на среднем пальце указала место напротив. Сергей сел, поставил свой одноразовый стакан. Он-то надеялся, что туристические ботинки и куртка, завязанная вокруг пояса, сработают.
  - О-кей, как вы догадались, что мне не нужно в центр?
  - Вы знаете дорогу, - объяснила она. - Вы живете здесь, в Нотвилле, я вас видела не менее десяти раз. И, я думаю, вы что-то вроде копа в штатском. Итак?
  Вот тебе и чокнутая старуха. Сергей отсалютовал ей стаканом с кофе.
  - Вы совершенно правы, миссис Томсон. Меня зовут Серж Островски, я частный детектив, и меня нанял Ивен Стрингер из Repeat&Return. Вы, вероятно, слышали, в чем его обвиняют. Обвинение представляется ему несправедливым, и у него нет таких денег. Нам нужны доказательства против истца: мы считаем, что он хотел лишиться пальца.
  - Почему вы решили, что у меня есть доказательства?
  Изобразив приличное смущение, Сергей рассказал ей, как разбирал комменты. Интеллектуалы-гуманитарии на такое обычно сердятся, - нарушение личного пространства, полицейские приемы, - но она только хмыкнула.
  - Не говори или не жалуйся, что тебя слышали... Что ж. Новак - внучатый племянник моего мужа. Артур страдает хроническими болями в пояснице, мы делаем ему уколы анестетика в определенные точки. Этот Новак зачастил к нам в гости, а потом украл две ампулы.
  - Вы видели, как он их брал?
  - Нет, но их было тринадцать, а после его визита осталось двенадцать. Артуру я ничего не сказала, разумеется. Вилокаин не наркотик, и зачем ссорить их с племянником, - мой муж последнее время не выходит, а Крис его развлекал. Потом история повторилась - в следующей упаковке было восемнадцать, стало семнадцать, и после этого он больше не приходил. А потом эта история с его пальцем. Я сразу все поняла.
  - Вы поняли, зачем он это сделал?
  - Я не знаю, зачем он это сделал, и это меня не интересует. Может быть, он сумасшедший. Но то, как он подставил этого бедного мальчика, специалиста по трехмерным копиям... - она сокрушенно покрутила головой. - Вы говорите, он требует денег?
  - Сто тысяч. Миссис Томсон, - Сергей подался вперед и поймал ее взгляд, - вы уверены? Вы могли бы подтвердить под присягой, что две ампулы пропали во время визитов Новака?
  Клэр Томсон поглядела на него снисходительно. Затем повернула голову, позируя в профиль, и двумя пальцами подняла седые волосы над ухом. Ухо не было заостренным. О нет, гораздо лучше!
  - Я уже позабыла, как это вдохновляет, когда мужчина вот так на меня смотрит, - она усмехнулась, показав белоснежные зубы. - Да, я могла бы подтвердить под присягой, и нет, я не ошибаюсь.
  Выпуклая, телесного цвета наклейка на виске, формой напоминающая бумеранг или русскую букву Г, - мнемопротез, поддерживающий функцию гиппокампа. Показания таких людей часто приравнивают к документам, у них эйдетическая память. Выдавать себя за туриста было глупо. Старая дама при желании могла бы не только подсчитать, сколько раз до сего дня она видела Сергея Островски, или любого другого человека, но вспомнить дату, время и обстоятельства каждой встречи.
  - Миссис Томсон, это просто классно. У меня счастливый день. И вы могли бы сказать мне, когда он начал бывать у вас и когда пропали ампулы?
  - Конечно. Позвольте, я открою календарь, вам ведь нужны числа, а не дни недели?.. Первый раз он пришел четырнадцатого февраля, принес мне цветы, наглец. До того никогда не бывал у нас, только присылал поздравления по праздникам. Потом заходил еще три раза, пятого, двенадцатого и двадцать второго марта - тогда взял первую ампулу, потом еще второго и седьмого апреля. Вторую он украл четырнадцатого апреля и больше не появлялся.
  За пять дней до инцидента с пальцем. Это хорошо, а вот вифон в ее руке... Такой был у бабушки по отцу: плоский, блестящий, будто из черного стекла, свечение экрана с оттенком в синий. На поверхности экрана, когда он гаснет, видны радужные переливы, корпус тоже выглядит новеньким. Как будто его только что вынули из коробки. Или из зоны печати. Старый мягкий пластик таким блестящим быть не мог, сколь бы аккуратно с ним ни обращались.
  - А если кто-то другой сделал укол?
  - Кто? Мы живем вдвоем, у нас редко кто-нибудь бывает.
  - А сам мистер Томсон? Ведь мог быть внезапный приступ, он не захотел вас беспокоить...
  - Молодой человек, - баритон Клэр исполнился яда, - доживите до девяноста лет, и я посмотрю, как вы сами себе сделаете укол в это место! Две ампулы взял Крис Новак, я скажу это и в суде.
  - Благодарю вас, миссис Томсон. Насколько я знаю, вы одна из немногих, кто сочувствует моему клиенту. Так мило с вашей стороны, ведь общественное мнение против него.
  - А я против общественного мнения. Мне не привыкать.
  - Это единственная причина?
  - То есть?
  - Вы не знакомы с мистером Стрингером?
  Это движение глаз и бровей, прежде чем ответить "Кажется, я как-то обращалась к нему"... "Кажется", о да. До чего избирательно у женщин работает эйдетическая память! Хорошо, не будем давить.
  - Разрешите еще один вопрос. Новак ничего не говорил при вас о своих финансовых проблемах, о том, что ему нужны деньги?
  А вот этот вопрос был неудачным. Он слыхал еще в полицейской академии, что у свидетелей, носящих мнемопротезы, бывают резкие колебания настроения и потому обращаться с ними надо по-саперски бережно и аккуратно.
  - Нет, не говорил, - холодно ответила миссис Томсон. - С какой стати ему было об этом говорить? Он не настолько близкий родственник, чтобы рассчитывать на финансовую помощь или наследство. Серж, если у вас всё, я хотела бы немного почитать. Вам нужны мои координаты?..
  
  
  Сергей ретировался за свой столик, допивать остывший кофе. Вместо обычных кусочков сахара в сахарнице сверкали белизной ажурные сферы и кубики, каждый со своим узором. От 3D-печати сегодня решительно некуда было деваться.
  Чтобы узнать, какие неприятные воспоминания мог воскресить у миссис Томсон последний вопрос, долгих поисков в Сети не потребовалось. Артур Томсон в январе прошлого года перечислил крупную сумму своему бывшему театру, об этом много писали. Настолько крупную, что это вызвало неудовольствие детей и прочих наследников...
  Кстати, копия вифона вместо старого может понадобиться, если в старом есть что-то компрометирующее. Что-то, что требуется скрыть от мужа или других членов семьи... Нет, Островски, это тебя не туда понесло. Тогда копия должна была бы выглядеть старой, так? Но это еще одно любопытное применение 3D-печати. Фабрика фальшивых улик.
  Когда он поднял голову, Клэр уже не было. Доела свой десерт и удалилась. Впрочем, оставался еще один ресурс: хозяйка кафе, которая незаметно, по ее мнению, рассматривала его из-за стеллажа с пирожными. Красивая дама, немного слишком крупная для того, чтобы ее красота всерьез отвлекала от расследования. Зовут Рита. Сергей сел к стойке, попросил воды с апельсиновым соком и десерт по ее выбору.
  - Мне показалось, вы подружились с нашей Клэр?
  "Нашей" прозвучало собственнически: так хозяева заведений говорят о постоянных посетителях.
  - Просто подошел познакомиться. Знаете, ведь ее муж - режиссер Томсон, это при нем театр поставил "Сон в летнюю ночь" на реке, под открытым небом.
  - Ой, правда? А я не видела.
  - У вас не было ни единого шанса, - галантно сказал Сергей. - Шоу прекратилось еще в сороковые.
  Рита кокетливо рассмеялась.
  - Да, они оба совсем старенькие! Его я никогда не видела, а она часто заходит. Через день, через два.
  - Давно?
  - По-моему, всегда! Не помню времени, когда она не заходила.
  - У нее такой странный вифон, - кинул Сергей пробный камень.
  - Это не вифон, дорогой. Это называется тилифон
  - Простите?
  - Тилифон, - важно произнесла хозяйка. - Они были до вифонов, может быть, видели в "Миллениуме"? Там у всех героев такие. Без клавиатуры, без кино и видеосвязи, только говорить и читать, и еще фотоаппарат в них был.
  - То есть этому устройству лет пятьдесят? И оно работает?
  - О, ну, именно этому, я думаю, не больше года, - хозяйка загадочно опустила темно-синие ресницы.
  - Как так?
  - Сейчас расскажу. Это было как раз год назад. Сидит Клэр, вот там же, за своим столиком. Заходит другая старушка - ее дочь, я потом поняла. Сначала все нормально, поцеловались, сделали заказ, общаются. Потом начали ссориться, что-то насчет обязательств, долга, ну вы представляете, семейные дела. А потом мать отвернулась и достала свой тилифон - мол, больше не хочу с тобой говорить. А дочь выхватила его - и швырнула об пол, и каблуком прямо на экран.
  - Какие страсти.
  - Страсти, ага. А та: ах-ах, что ты делаешь, папа мне подарил его на нашу годовщину! А эта такая: я знаю! Повернулась и пошла. Вот какие стервы бывают на свете. Что бы она ни сделала, она мать тебе, я так считаю.
  Сергей сомневался, чтобы Клэр могла произнести "ах" даже в такой ситуации, но вся сценка была представлена живо. Шекспировской труппе мистера Томсона было бы чему поучиться.
  - А что дальше?
  - А дальше вот что. Она сидит так (хозяйка уперлась локтями в стол и сцепила пальцы перед подбородком). Сидит молча и слезы: кап, кап. Я хотела к ней подойти, но тут морозилка запищала, десерты надо было переставить. А потом смотрю - с ней рядом эта девочка. Уже подобрала обломки, разложила на столе, и что-то такое водит пальцами в воздухе, что-то ей объясняет...
  - Какая девочка?
  - Из ремонтной службы. Чинила у нас мороженицу, потом я ей, конечно, собрала бесплатный бранч. И вот она, значит, сидит рядом с Клэр, гладит ее по руке, что-то обещает. А потом забирает обломки и уходит. А через день, смотрю, Клэр моя пришла веселая, спокойная. И тилифон опять у нее, точно такой, как тот был.
  - Надо же. А что за ремонтная служба, не помните?
  - Ой, откуда? Сломалась мороженица, там какая-то маленькая штучка в мешалке. Мы вывесили тендер на сайте, они выиграли.
  - А в той девушке было что-нибудь особенное?
  - Милый, я девушками не интересуюсь! Помню, что совсем молоденькая, я даже удивилась, что она в технике понимает. Одета по-чудацки, стриженая как мальчик, и ушки смешные - вот такие, как ручки у кастрюли. Я бы на ее месте ушки прикрывала прической.
  
  
  Выйдя в маленький сквер, Сергей присел на ограждение у клумбы. Солнце сверкало сквозь листья, мимо пробежал мальчишка, ведя пластиковым мечом по рифленому заборчику.
  В сущности, уже можно отчитаться перед клиентом. Человеку, который украл анестетик и сделал себе инъекцию, не стоит публично утверждать, будто он не знал, что произойдет с его пальцем. Но раздражает отсутствие одного крохотного фрагмента: доказанного мотива.
  Предположения о том, что Новак как-то завязан с торговлей антиквариатом, или ненормален, или на кого-то зол, не подтверждаются. Зато всплыл компромат на Стрингера. Безусловно, ушастая девица из ремонтной службы - это Пэм, и помощь пожилой леди была нарушением копирайта. Копия такого старья наверняка нелицензионная, когда их выпускали, не было никакой 3D-печати. Ясно, почему Клэр не удержалась и вступилась за Стрингера в Сети. Повторить и вернуть подарок мужа - это дорогого стоит.
  Изготовление "тилифона" - преступление небольшое и, очевидно, никак не задевающее интересы Новака. Но если Стрингер сделал это один раз, то мог сделать и другой. Мне показалось, он и вправду не знает, что Новак имеет против него. Притворялся? Или, возможно, ему известна только часть истории, если он выполнял заказ или просьбу другого человека? Надо спросить его как следует, занимался ли он этим. Парень, можешь выдохнуть, я не бренд-аудитор, я сыщик, которого ты же и нанял...
  Обидно будет, если Новак все-таки окажется ненормальным. Такой красивый сценарий с торговлей поддельным антиквариатом!
  Да, вот еще что у меня осталось: почему Калифорния? Какого черта Новак поехал протезировать свой палец в Сан-Диего, к самой мексиканской границе? Чем его не устроили нотвильские клиники? Есть какая-то ирония в том, что новый палец ему сделают с помощью технологий 3D-печати, будь он живой, из его собственных клеток, или нейроуправляемый протез... Или, может, никакого протеза ему не делают, а в Сан-Диего сидит обманутый клиент, который устал ждать денег и настаивает на личной встрече? Для начала надо попытаться узнать, действительно ли он в этой клинике. Как там сказал Эмери - Калмановский или Колмановский университетский нейрологический центр?..
  Центр нашелся моментально. На главной странице красовался мозг, в котором вспыхивали и гасли разноцветные линии, замысловато изломанные и переплетенные, как маршруты на карте подземки большого города. Ортопедия и протезирование в перечне услуг были. Сергей открыл одно подменю, другое...
  Рита из кофейни наблюдала через окно, как давешний длинноволосый посетитель, сидевший у клумбы, вскочил на ноги и исполнил нечто вроде джиги, беззвучно хохоча и прижимая вифон к груди, а потом снова сел и начал что-то быстро набирать. Поднял голову от экрана и замер, глядя в небо. Посидел так с минуту и вернулся к письму. Вот интересно, что человеку могла написать женщина, чтобы он был такой счастливый. А еще говорят, современные мужчины не способны на искренние эмоции...
  
  ***
  
  - У меня хорошие новости, мистер Стрингер. Я получил надежные доказательства, что Новак перед тем, как совать палец в ваш принтер, ввел себе анестетик.
  - Значит, он сделал это нарочно! - Ивен просиял. - Как я и говорил. Спасибо вам, мистер Островски. Думаю, с этим можно идти в суд?
  - Вы правы. Но у меня есть еще одна идея. Новак сейчас в Сан-Диего, в Колменовском центре медицинских исследований. Мне кажется, я знаю, зачем он там.
  - Ему делают новый палец?
  - Можно и так сказать. Но я должен убедиться... уточнить кое-что. А для этого необходимо повидаться с ним лично. Он заблокировал адрес, но я обратился в этот центр, попросил связать меня с ним. Сказал, что представляю ваши интересы, в подробности не вдавался. Он согласен на встречу.
  - Лично? - Ивен наморщил лоб. - В Сан-Диего? А не проще связаться по Сети?
  - Нет, боюсь, не проще. И я почти уверен, что уговорю его отозвать иск. (И мне просто любопытно, но это мы не станем обсуждать.) Если так будет, вы вернете мне стоимость билета на самолет?
  - Если он отзовет иск... конечно, мистер Островски, разумеется. Но скажите, что вы такое про него поняли?
  - Скажу, как только смогу доказать. А пока... знаете, мой дядюшка любит рассказывать такую историю. Когда-то давным-давно, когда автомобили еще заправляли бензином из нефти, один тип купил себе машину. Новенькую и очень-очень крутую, ни у кого такой не было. И вот он с друзьями обмывает покупку и говорит: спорим, что я прямо сейчас забью в крышу моей новой тачки пятидюймовый гвоздь? Друг ему: да ладно, ставлю сто долларов, что ты этого не сделаешь. Ах так? - говорит тот тип и встает с места. Все идут в гараж, он вынимает из-под верстака ящик с инструментами, берет молоток, берет гвоздь, и... - Сергей изобразил удар молотком.
  - И в чем подвох?
  - Друзья так же спросили. Каждый подошел, подергал гвоздь, ощупал крышу - забыл добавить, что тогда кузова автомобилей были металлические. Никакого обмана: листовой металл, большой ржавый гвоздь, сквозное отверстие, острие торчит из потолка салона. Все хором сказали: "Ну ты и дурак", тот, кто поспорил с ним, отдал сто долларов, и пошли допивать.
  - Но это не конец истории?
  - Не конец. Через неделю друзья увидели, как он рассекает на своей машине. Он сделал в крыше люк - такой квадратный, раздвижной, тогда это был самый предел крутизны. Установка люка обошлась в сто долларов.
  Ивен запустил пальцы в шевелюру на затылке, да так и встал, сам себя держа за волосы.
  - Ага. Стойте. Если это была крыша, то что у нас люк?.. - Моргнул, пошевелил губами, и вдруг лицо его озарилось пониманием.
  Сергей улыбнулся ему, сделал прощальный жест и вышел.
  
  ***
  
  Самолет прилетал в пять утра по Сан-Диего, других вариантов не было. Однако дома было уже восемь, в полете Сергей успел вздремнуть, и спать уже не хотелось. Он отправил контрольное ОК маме (потому что лучше это сделать, чем забыть), арендовал машину и поехал в направлении Колменовского медицинского центра.
  Калифорнийские пальмы - плюмажики перистых листьев на высоченных столбах - забавно пародировали прожекторы вокруг летного поля. Небо над аэропортом уже с утра казалось пыльным, выцветшим от жары, но что-то в его оттенке намекало на близость океана. Сергей даже углядел справа от шоссе, за шеренгой пиний, бледно-голубую воду залива. Прямо по курсу небо розовело. Полицейские очень смешно выглядят на фоне зари, вспомнил он. А частные сыщики - тем более обхохочешься.
  Сообразив, что в клинике еще все спят, стал выглядывать на карте навигатора мотель подешевле. Мотели тут были через каждые двести метров, и он повернул к ближайшему "минимуму". Пару часов провалялся на койке в тесном номере, лазая по Сети. Полезные для беседы материалы оказались такими искрометными, что он все-таки задремал. Проснулся от колокольчика почтовой программы: 8:15, Крис Новак готов увидеться с ним.
  Дорога не заняла и двадцати минут. Короткая дорожка вела от шоссе к белому зданию затейливой архитектуры, - цилиндрические корпуса, соединенные переходами в виде римских акведуков, стеклянные фасады сине-бирюзовые, такого цвета бывает вода в бассейне. Белую стену у центрального входа украшают зеркальные буквы UCSD. И вокруг те же пальмы - как огромные хвосты с помпонами, воинственно задранные в небо.
  Новак ожидал его в парке. Сидел на белой скамье под обильно цветущим деревом, держал в руках какой-то гаджет и гладил его, будто кошку. Лет сорок, весь какой-то бесцветный. Лицо правильное, но из тех, которым художник забыл добавить красок и блеска. Мраморная парковая статуя? Скорее фигура из папье-маше.
  - Доброе утро, мистер Новак, - Сергей протянул ему руку, Новак отложил свой гаджет, привстал и, отвечая на пожатие, странно махнул в сторону левой рукой, словно ловя равновесие. Правая рука у него была холодная, видимо, долго сидел неподвижно в тени. - Меня зовут Серж Островски, я представляю интересы мистера Стрингера.
  - Зачем у вас диктофон? - голос сухой, монотонный, с ноткой превосходства.
  - Диктофон? - невинным тоном переспросил Сергей.
  - Вот здесь, - указательный палец левой руки уперся в нагрудный карман его рубахи. - Он у вас включен. Не надо этого. И очки тоже выключите.
  Сергей вытащил из кармана диктофон, придавил кнопку, показал Новаку табло. Потом снял зеркальные очки.
  - Очки выключены, можете убедиться, - вручил их собеседнику. - И спасибо, что облегчили мне разговор.
  - Что вы имеете в виду?
  - Вы сделали себе не простой протез. У вас теперь вместо указательного пальца сенсор электромагнитных излучений, верно? Датчики Виганда или что-то в этом роде. Местная специализация, такого больше нигде не делают.
  Новак иронически скривил лицо.
  - Вы так говорите, будто это что-то плохое. Если я лишился пальца по вине вашего доверителя, то могу заменить его хоть фонариком, хоть ключом от банковской ячейки. Это мое дело.
  - Разумеется, мистер Новак. Но проблема в том, что вы причинили себе увечье сознательно. Видеоочки врача скорой помощи зафиксировали следы уколов на вашей левой руке, а Клэр Томсон, супруга вашего родственника, показала, что вы украли у них вилокаин. Хорошо придумано - покупка оставила бы следы в Сети. Вы ведь не знали, что у нее мнемопротезы?
  Новак ничего не ответил.
  - Да, технологии - то, что меня всегда поражало. "Новые чувства", как это называют, правильно? Я всего день как пытаюсь в этом разобраться, могу что-то спутать. Сенсорные сигналы от пальцев идут в кору мозга, там пальцам отведена территория величиной с Техас. Нет пальца - нет сигналов, кора страдает без работы, и ее легко загрузить новыми задачами. Это лучше, чем фантомные боли. Но врачам запрещено проводить ампутации, чтобы поставить пациенту инфракрасный либо электромагнитный сенсор, - за это отбирают лицензию. Вы могли бы, скажем, отрубить себе палец топориком и придумать правдоподобную историю о приготовлении барбекю в пьяном виде. Но предпочли совместить неприятное с полезным - и пальца лишиться, и раздобыть денег на дальнейшие манипуляции. Долго искали такое место, где командует наивный энтузиаст, не слишком озабоченный техникой безопасности?
  Не люблю, когда собеседник так молчит. Поди пойми, что он тебе готовит, - то ли сейчас признает поражение, то ли начнет драться.
  - Мистер Новак, согласитесь, что вы не очень хорошо поступили с моим клиентом. Я не адвокат, если вы хотели спросить, - я частный детектив. ...Так вот, он годится вам в сыновья. Он не торгует воздухом, а работает руками и головой. А вы фактически собирались его пристрелить. Конечно, вы понимали, что его скромный бизнес не выживет, если судебное решение будет в вашу пользу?
  Тонкие губы наконец-то разжались.
  - У меня в его годы не было собственного дела. Никогда не было. Всегда был наемным работником.
  - Что вам помешало?
  Молчание. Неразговорчивый собеседник попался.
  - Послушайте меня, мистер Новак. Вы, наверное, уже поняли, что с той информацией, которая у нас есть, мой клиент не проиграет дело. Более того, самоповреждение с целью вымогательства - неприятные слова. Но у меня к вам хорошее предложение. Отзовите иск против Стрингера, скажите, что это была ваша вина и ваш просчет. И если к вам обратятся новостники и блогеры, не сочтите за труд подтвердить, что сами себе откусили палец. Насчет причины - я бы рекомендовал невроз от переработки. Сами не знали что делаете, вдруг захотелось... меня уверяли, что так бывает.
  - Если б я знал, что мальчишка наймет детектива... - Новак потер себе лоб.
  - То что? Действовали бы хитрее? ...Знаете, мистер Новак, замыслы вроде вашего не приводят к успеху, когда начинаются с подлости. Вы хотите стать супермастером, и станете им, но это был бы плохой старт. И ладно бы у вас не было денег...
  Новак судорожно вздохнул.
  - Как меня достали моралисты со всеми козырями на руках. Не надо мне ваших проповедей. Я отзову иск. Если хотите, отправлю письмо прямо при вас.
  - Это верное решение. Спасибо вам большое.
  - И от ваших комплиментов меня избавьте.
  - Я понимаю. Мистер Новак, если позволите, еще личный вопрос?
  - Личный? - Новак поморщился. - Слушаю.
  - Это ваше шестое чувство. Как оно работает? Электромагнитные поля - они холодные, горячие или какие?
  Новак несколько секунд разглядывал его в упор. Потом улыбнулся.
  - Не то чтобы... Да, пожалуй, холодные. Они вроде воздушных потоков, но только один палец их чувствует. Знаете, как бойскаутов учат определять направление ветра - оближешь палец, поднимешь и чувствуешь холодок. Близко к источнику бывают очень холодные. Как ледяные градины. Или как мята, это не настоящий холод... Но у них есть плотность, и еще... Представляете индейские плетенки из бисера? Вот когда я приближаю палец к микросхеме, я чувствую что-то вроде этого.
  - Невидимые бусины?
  - Да, невидимые. Только у них есть цвета, и они шевелятся. Знаю, звучит так, как будто я спятил. Доктор говорит, чтобы я тренировался и записывал свои впечатления. Говорит, что мой мозг сейчас сам определяет, как и что я буду чувствовать, он составляет свою кодировку, для вектора индукции, для напряженности. Что-то будет цветом, что-то теплом или фактурой. Я постепенно разберусь.
  - А у людей есть поля?
  - Ха! У тех, кто носит на себе гаджеты. Биополей нет, или, по крайней мере, я их не ощущаю.
  - Вы не жалеете, что сделали это?
  - Нет. - Новак энергично помотал головой. От его флегмы не осталось и следа. - Не жалею. Ни одной секунды.
  - А вы планируете вернуться в Нотвилл?
  - И что, если планирую?
  - Ну, мы с вами могли бы обменяться контактами. При моей работе бывают нужны консультации специалистов, разумеется, платные.
  Новак опять умолк. Но теперь было похоже, что он не верит глазам и ушам и едва сдерживается, чтобы не исследовать левой рукой сидящий рядом с ним феномен. Дабы проверить наличие встроенного генератора абсурда.
  - Ты только что забрал у меня сто тысяч долларов и теперь предлагаешь поработать на тебя?
  - Так в этом и дело! - с готовностью объяснил Сергей. - Я хотел бы скомпенсировать вам ущерб, хотя бы маленькими порциями.
  - Видал я бессовестных типов, но не таких, - проворчал человек с шестым чувством и вытащил свой вифон.
  
  ***
  
  Уже подойдя к машине на стоянке, Сергей получил сообщение. Ивен перевел ему деньги: и оговоренную сумму гонорара, и стоимость билетов. Жизнь повернулась светлой стороной.
  Детектив Сергей Островски оглянулся - не видит ли кто, - облизал палец и поднял его вверх. Ветра не было вообще, ниоткуда. Хотя... кажется, там у нас океан? Жара еще не достигла пика, и до регистрации на обратный рейс остается часа четыре. Вполне можно успеть на пляж.
  
  
  Московские каникулы
  
  Серое небо, крыши и фасады серых и бурых домов. На одной крыше, клянусь, печные трубы! Или все-таки выходы вентиляционных шахт?.. Далеко внизу безрадостно-белые квадраты газонов, черный асфальт в белых штрихах недочищенного снега. С высоты не видны ледяные блямбы - на одной такой он вчера поскользнулся, ничего важного не повредил, но брюки изгадил холодной жижей, пришлось вернуться и переодеться. Рыжий уборочный скутер фонтанирует грязью, обводя белый газон траурной каймой. С добрым утром, милый город... Ладно, будем объективны: Нью-Йорк под зимним пасмурным небом тоже не радует.
  Зато квартиры всех московских родственников и знакомых так уютны. Шелковые шторы, чисто умытые цветы в горшках на широком подоконнике - и тусклый день за стеклом становится неправдоподобным, как театральное фальш-окно. Свет в кухне летний, янтарно-желтый, пахнет кофе и поджаренным хлебом, и за деревянным столом в углу - мягкий полосатый диванчик. Совсем не хочется на улицу, к музеям и прочим достопримечательностям. Хорошо, что мама отправилась на дачу к дяде Паше и тете Ляле, а Сергея оставила в их квартире, на попечение Ариадны.
  Пятнадцатилетняя дочка маминой сестры сперва стеснялась, а потом решила, что Сергей нестрашный, и начала задавать вопросы. Самые разнообразные.
  - Круто, чё. Мой брат - американский детектив! - Русский язык не всегда различал брата и кузена, зато предусматривал церемонное обращение к старшим во множественном числе. - Вы умеете вертеть пистолет на пальце? - Она показала, как именно.
  - Никогда не пробовал.
  - А говорить "аста ля виста, бэби"?
  - Это другой персонаж, не полицейский.
  - Неважно.
  - Сейчас попробую. - Сергей сделал морду кирпичом, выпрямился и сурово произнес, воздев руку: - Асс-та ля висс-та, бэби.
  Ариадна рассмеялась, как смеются только юные девы и только по пустякам. Коротко остриженные волосы делали ее похожей на некрасивого ангела - из третьего ряда ангельского хора, где старый мастер пишет только юность и чистоту без особых примет. Флотская фуфайка весьма полосата, джинсы болотного цвета прострелены навылет в трех местах, сквозь пулевые отверстия видны лиловые колготки, в набедренном кармане что-то постукивает и перекатывается при каждом шаге. Сочувствую Тезеям и Минотаврам.
  - Будете клубничное варенье?
  Девочка достала с полки хрустальную вазочку на ножке, аккуратно начала перекладывать в нее прозрачную рубиновую массу, и тут Сергей понял, что ожидал иной сервировки. Скажем, так: коробка кукурузных хлопьев, пакет молока, арахисовое масло или то же варенье в банке с торчащей из нее ложкой.
  Тут имел место гостевой завтрак на двоих... на две персоны. Как в лучших домах. Белая скатерть, на безупречных лавандовых салфетках - белые тарелки и пиалы для утренней каши, поджаренный хлеб в плетеной корзинке, кружочки колбасы и ломтики сыра, аккуратно разложенные на пластинке сиреневого фаянса. Аля взяла за ручку заварочный чайник, перстень в виде гайки цокнул о фарфор. Собирала на стол она бездумно, машинально, как другие такие подростки вскрывают банку кока-колы.
  Поужинав и позавтракав с ней, Сергей успешно обновил свой разговорный русский. "Круто, чё" означало "неплохо", а "офигеть теперь" - "не так хорошо, как в гордыне своей полагает собеседник". Когда он чего-то не понимал, Аля легко повторяла фразу на английском. Кладут ли крутые американские детективы варенье в овсянку? А почему бы и нет, если им предлагают...
  Сигнал вифона. Мама. Да, конечно, встал, давно позавтракали, практически уже в ботинках и шапке, иду в музей. В какой? О, в этот, как его...
  - Сережа?
  - Мама, что случилось? - По ее голосу он понял, что это не обычный контрольный звонок.
  - Паша пропал.
  - Как пропал? - переспросил Сергей. И пока ему выговаривали за тупость и объясняли, как пропадают люди, он смотрел на Ариадну. Та гипнотизировала прозрачный тостер, дожидаясь правильного золотистого оттенка.
  До сих пор - до этого странного ощущения где-то под ребрами - он не подозревал, что успел привязаться к московской сестренке. И забыл, как это бывает, когда беда приходит не к чужим, а к тем, кого любишь.
  
  ***
  
  В загородное такси они сели вдвоем. Ариадна не плакала, но лицо ее больше не казалось детским. Сергей устроился с ней рядом на заднем сиденье.
  Ховеркрафты в Москве называли аэроходами и еще иногда "ползолётами". Этот скорее летал, чем ползал, судя по высоте, на которую взметнула их воздушная подушка. Сергей понадеялся, что водитель по имени Камиль не станет срезать путь через поле или руслом реки, но невозможным это не казалось.
  - Я на него рассердилась, - тихо сказала Ариадна. - На папу. Когда он не приехал на награждения. Я победила на всероссийской олимпиаде, а он сказал, что ему надо работать. Он все время сидит на даче и работает.
  - Он крупный ученый?
  - Типа да, - Аля усмехнулась. - Я с ним потом неделю не разговаривала. А теперь он пропал.
  Сергей начал объяснять, что не надо сразу воображать все самое плохое и что недоразумений в мире гораздо больше, чем настоящих несчастий, но тут впереди возникла пробка. Такси повышенной проходимости, лишь немного замедлив ход, повернуло на обочину, форсировало ограждение, затем сугроб и, взметая снежно-грязевые вихри, поплыло вдоль шоссе над кустами и пешеходной тропинкой, провожаемое жестами и комментариями других водителей. Сергей промолчал - сам просил, чтобы побыстрее.
  Никого из российских родичей, кроме тети Ляли и бабушки, Сергей до того не видел в реале, ни с кем не поддерживал связи - созванивались, когда напоминалка сообщала о чьем-нибудь дне рождения, и на этом всё. С американской родней дело обстояло примерно так же. Он не умел и не любил делать длительные визиты и отдыхать "как положено", планируя безделье и развлечения, притворяться, что рад видеть малознакомых мужчин, женщин и детей. Родственники - странные люди, которые, подобно тем существам из рассказа Роберта Шекли, почему-то должны собираться вместе при изменении их количества... Однако родословное древо со всеми нужными примечаниями Сергей знал наизусть. Осведомленность можно выдать за интерес, а вопросов вроде "какая тетя Миджен и кто такая Катька" мама ему не простила бы.
  Поэтому он примерно представлял, кого увидит в загородном коттедже. (В Москве говорили "на даче", от слова "дать" - некогда так называли владения, которыми царь награждал особо отличившихся подданных.) Отметить день рождения Павла Георгиевича собрался узкий семейный круг. Родная сестра жены, то есть мама Сергея. Марина, дочь тети Ляли от первого брака; муж Марины Виталий. Вадим - сын дяди Паши от одного из двух предыдущих браков. И наконец, Нина, старшая сестра именинника.
  С маминых слов, вчера все было благостно: шампанское на заснеженной лужайке, семейный ужин у теплой печки, сольное и хоровое пение. А утром оказалось, что дядюшка исчез, никого не предупредив и не взяв, по-видимому, никаких вещей, кроме одежды, что была на нем.
  Дядя Паша, Павел Георгиевич Зарубин - физик, работал в Лебедевском институте, лет десять назад сделал какое-то крупное открытие, значительной научной и коммерческой ценности. В настоящее время он безвылазно сидел в своем коттедже, нигде не числился в штате, благо возраст был пенсионный, и занимался теоретической физикой. Кажется. Сергей не мог бы сказать, почему он решил, что именно теоретической физикой. Дядя все время сидел за компьютером, от компьютера его отрывала тетя Ляля, когда Сергей им звонил. Но если подумать, с тем же успехом он мог моделировать технологические процессы. Или писать мемуары. Или даже играть в "Осаду Иерусалима".
  Вторая пробка ожидала их в небольшом городке, где к шоссе с обеих сторон примыкал противошумовой забор, так что трюк с объездом не прошел бы. Сергей вспомнил страшные рассказы коренных москвичей и приготовился к великому стоянию. Однако водитель вытащил свой вифон, поводил пальцем по экрану, удовлетворенно хмыкнул и втопил педаль. Сергею показалось, что они пошли на таран, он выбросил руку вправо и схватился за ручку дверцы, чтобы девчонку не кинуло вперед при ударе, но тут мощно взвыли верхние импеллеры, нос ползолёта задрался, и в следующее мгновение под ними поплыли разноцветные крыши машин. Камиль объезжал пробку поверху. Салон покачивало, будто они ехали по подвесному мосту, и Сергей буквально чувствовал, что держат машину на весу не только воздушная подушка и винтовая тяга, но и добрые пожелания, идущие снизу. В гладких зеленоватых щитах по левому борту виднелось их отражение; Сергей глянул на него и сразу отвел глаза.
  Аля нисколько не испугалась, ее "ух ты, круто", похоже, Камилю польстило. Сергей же перевел дух, только когда машина спустилась на грешную землю и, как в прошлый раз, заскользила по обочине вдоль бесконечного ряда машин. Он попытался подсчитать, в какую сумму подобные маневры обошлись бы по другую сторону океана, и не смог.
  - Нас не оштрафуют? - спросил он нейтральным тоном, изо всех сил поддерживая репутацию американских детективов.
  - Не волнуйтесь, - был снисходительный ответ. - Добрые люди пишут, тут камеры сломаны.
  - А другие водители не пожалуются?
  - У меня номер плохо виден. Грязь на дорогах такая.
  - А-а... бортовой идентификатор?
  - Помехи идут, - флегматично сказал Камиль.
  Остаток пути Сергей больше размышлял о национальном менталитете, чем о пропаже родственника. Ариадна привалилась к его плечу и заснула. Толстая пуховая куртка придавала Сергею сходство с подушкой, и обращались с ним соответственно, то бесцеремонно тащили на себя, то уминали кулачком.
  
  ***
  
  Въезд в поселок охранял автоматический шлагбаум с регистратором и видеокамерой. Сергей было обрадовался - значит, все, кто въезжал и выезжал, сосчитаны. Потом кинул взгляд на обширное пустое поле по правую сторону от дороги и радоваться перестал. Вдобавок последние сорок минут шел снег. Следы возле дома найти будет нелегко, а без аппаратуры просто невозможно. Вопрос в том, когда туда прибыла местная полиция и прибудет ли она вообще...
  Поселок показался ему похожим на пригородную зону американского городка, только дорога поуже, заборы повыше и деревьев на участках больше. Крыши домиков никто не чистил, они белели, будто сложенные вдвое листы бумаги. Над воротами с медными цифрами 27 только крыша и была видна - треугольный фасад с большими чердачными окнами да рядом верхние ветви роскошной сосны. Сергей мысленно извинился перед русскими коллегами: полицейский автомобиль с синей полосой по борту уже был у ворот. Аля поднесла к замку свой ключ, калитка распахнулась.
  На площадке у ворот стояли автомобили. Сергей узнал "раду" апельсинового цвета, которую арендовала себе мама на время отпуска. Кроме того, здесь был мощный внедорожник, навевающий армейские ассоциации, и синенькая кокетливая "хонда"-гибрид. За ней притулился маленький ховеркрафтик, смешно развесив в стороны алые лопасти винта; снегу на нем было меньше, чем на остальных машинах.
  По обе стороны дорожки тянулась полосатая лента, правая обводила лужайку, где стоял одинокий стол - очевидно, это здесь вчера пили шампанское; на веточках кустов еще посверкивал пестрый хлопушечный мусор. Над лужайкой в мельтешении белых хлопьев парили синие уличные флайботы, поблескивая мокрыми боками. Неплохие боты, хотя не самой последней модели. Работают в автоматическом режиме - построились квадратной сеткой, и весь кордебалет движется синхронно, нащупывая короткими импульсами следы под снежной пеленой... Лицо Али стало испуганным - и ленту, и ботов она наверняка видела в криминальных новостях.
  - Ты чего? - спросил ее Сергей. - Нормальная процедура, так положено. Пойдем.
  Входная дверь вела в темный тамбур, холодный, пахнущий мехом и сукном, где нег медленно таял на полосатых половиках, а у стены выстроились разнокалиберные валенки. За второй дверью обнаружился уютный холл с винтовой лестницей на второй этаж. Мама обняла Сергея, захлопотала вокруг Ариадны, помогая ей снять куртку. Сергей шагнул в гостиную.
  - Здравствуйте.
  Бородатый человек, сидевший на низкой табуретке перед печкой, повернул голову в его сторону. Если это был Вадим (его Сергей прежде не видел и на экране), то на отца он мало был похож, и в плечах существенно шире.
  - Сереженька, доброе утро, очень рада тебя видеть.
  Тетины волосы, черные с серебряными полосками седины, лежали красивыми волнами, но макияжа на лице не было. Сказав "очень рада", она попыталась улыбнуться, и по голосу было слышно, как ей скверно.
  - Тетя Ляля, - Сергей подошел поцеловать ее в щеку. - Уже известно что-нибудь?
  Она молча помотала головой. Сергей раскланялся с остальными. Бородач действительно оказался Вадимом, сухопарая дама в кресле у окна, с кудряшками цвета луковой шелухи - Ниной Георгиевной, сестрой дяди Паши. Марину и Виталия он узнал сам - видел, когда звонил дяде с тетей по праздникам.
  На Марине была обтягивающая блузка с принтом под шкуру питона и домашние сапожки змеиной кожи. По мнению Сергея, вещи идеально подходили к стилю хозяйки. Когда вошли мама с Ариадной, сводную сестренку Марина приветствовала так: "Здравствуй, Алюша, здравствуй, дорогая". Ариадна буркнула в ответ "здрасьте", села рядом с матерью, обхватила ее руками, уткнулась в плечо. Тетя Ляля обняла ее все с тем же отсутствующим выражением лица.
  Виталий, аккуратный мужчина в очках-экранах и пуловере, сочувственно пожевал губами. Пуловер брендовый, прямо с картинки в журнале - "успешный человек отдыхает зимой на природе". Насколько Сергею было известно, настоящие успешные люди отдыхают на природе в других нарядах, хотя у московского бомонда могут быть свои обычаи.
  Доктор Анна Островски не была светской дамой, она предпочитала джинсы, свитера и всё, что не отвлекает и не мешает. Честно говоря, они с сыном были похожи больше, чем с сестрой. Только у мужчин не бывает такого лица - отражающего, как зеркало, чужую боль.
  - Мам, полиция тут?
  - Тут. Были какие-то, кажется, оперуполномоченные, нас допрашивали по одному, уже уехали. Следователь и эксперт сейчас в подвале с Эдом и Наташей.
  - С кем?
  - Эдуард - компьютерщик отца, - подал голос Вадим. Он закрыл дверцу печки и вместе с табуреткой повернулся к остальным. - В подвале есть серверная, "умный дом", еще кое-какая техника, они захотели посмотреть. А Наталья Владимировна - папин врач, ее вызвонили на всякий случай.
  Марина скривила личико.
  - Он вифоны у всех отобрал, этот эксперт. Если он там что-нибудь испортит, если что-то пропадет, он очень сильно пожалеет.
  - Мариночка, у нас беда случилась, - напомнила Нина Георгиевна.
  - Я не забыла, - холодно ответила Марина. - У меня там деловая переписка, записная книжка, заметки по работе.
  - Обычно все это копируют в компьютер, - глядя в пространство, сказала Нина Георгиевна.
  - Спа-асибо за сообщение.
  - Мам, а о чем они вас спрашивали? - вмешался Сергей.
  - Как полагается, обычные вопросы. Чем Паша болел, не любил ли розыгрыши, что из вещей пропало. Спрашивали, кто во сколько встал, когда поняли, что Паши нет. Он по утрам всегда сам приносил дрова для печки, Ляля сначала так и подумала, что он вышел за дровами, но прошло полчаса, сорок минут... Лялька! Тебе плохо?! Ну-ка, ну-ка, держись, не падай...
  - Мамочка!..
  - Ну вот, ребенка напугала. Аля, возьми на кухне, ты знаешь где, две капсулы в чашку. Лялька, пойдем. Я же тебе говорила, надо лечь...
  Как только за сестрами закрылась дверь, Нина Георгиевна тихо, но с большим напором сказала:
  - Вот. Я более чем уверена, все так и есть.
  - Тетя Нина, ну хватит уже, в самом деле, - неожиданно резко ответил Вадим. Кочерга, которую он прислонил к печке, упала, произведя неожиданно звучный удар, Вадим полушепотом ругнулся.
  - Не хватит, Вадечка! Я ничего не хочу сказать плохого про твоего отца, просто надо быть умнее и добрее к людям. А эта история - секрет Полишинеля, ее все знают, кроме, может быть, вас, детей.
  - Я не знаю, - подтвердил Сергей. - О чем речь?
  Вадим возвел глаза к потолку. Марина оживилась, приготовилась слушать. Лицо Виталия ничего не выражало, можно было подумать, что он читает или смотрит что-то на стеклах своих очков.
  - Да просто об одной Пашиной пассии, если можно так выразиться, - благонравно пояснила Нина Георгиевна. - Конечно, я бы не стала об этом говорить, если бы не ситуация. Это было двенадцать лет назад, он очень сильно увлекся Машей Звягинцевой, она работала у него в лаборатории - знаете, как это бывает. У них с Лялечкой едва не дошло до развода, а ведь была уже маленькая Аля! Я более чем уверена, это она.
  - Тетя Нина, с тех пор многое изменилось, - судя по тону, Вадим повторил это раз в пятнадцатый.
  - Что ты понимаешь, - непреклонно возразила Нина Георгиевна. - Ты подумай, подумай: кто еще мог его позвать, чтобы он побежал на улицу в чем был и исчез? Никому ни слова, ни записки, ничего... Я не знаю, что она ему наврала, но в том, что это она - абсолютно уверена.
  Вадим только вздохнул в ответ. А Сергей подумал, что вполне солидарен с дальней родственницей. Гипотеза о любовных мотивах заслуживала рассмотрения. Дядюшка и на экране выглядел эффектно, седые кудри и старомодные очки придавали ему сходство с Куртом Воннегутом, причем его остроумие было менее едким и более жизнерадостным. Блестящий оратор, удивительная эрудиция, а если вообразить, каким он был дюжину лет назад, - сотрудницу очень даже можно понять. Можно понять и немолодого мужчину, если внезапно объявляется его бывшая любовь и говорит... что именно - вопрос, но наверняка что-то драматическое, до такой степени, что он кидается вслед за ней. Седина в бороду и прочие пошлые поговорки. Глупый вариант, но не самый плохой.
  - Тогда почему он потом не написал? - перебил его размышления голос Марины. - Хоть бы короткое сообщение бросил, не ищите, мол, и не ждите...
  - Стыдно ему, - ответила Нина Георгиевна. ("Тетя Нина...", - простонал Вадим.) Наглая, наглая, бесстыжая баба, а Пашка - дурак и трусишка! А кто-то здесь слишком умный!
  Послышались шаги, на декоративной пленке в дверном проеме обозначились размытые силуэты. Первой вошла женщина лет около тридцати; угрюмое выражение лица и темно-каштановая коса, пушистым венком обводящая лоб, делали ее похожей на героиню какого-то фильма по мотивам русской классики. За ней - молодой брюнет бледного вида, с трагически заломленными бровями. Тот, кто придерживал его за локоть, невысокий и плотный, усмехался в русые усы. Четвертый, коротко стриженный блондин в золоченых очках, нес в руке чемоданчик с комнатными ботами, а на плече у него был экспресс-лаб.
  - Есть что-нибудь? - спросил его Сергей. Вырвалось само, по профессиональной привычке, и человек с чемоданчиком, кажется, даже собрался ответить, но, разглядев Сергея, осекся и спросил сам:
  - Простите, а с кем имею?
  - Сергей Островски. Я сын Анны Ильиничны, племянник пропавшего. Мы с Ариадной только что приехали.
  Тут как раз вошли мама с тетей Лялей, а за спинами полицейских появилась Ариадна с чашкой в руке.
  - А, вы родственник из Америки? Ариадна... дочь, прекрасно. Хохлов Алексей Геннадьевич, следственное управление (дальше следовала кириллическая аббревиатура, которую Сергей постарался запомнить, чтобы расшифровать на досуге) Московской области. Вы хорошо знакомы с вашим дядей?
  - Лично не знаю, общались по вифону.
  - Вчера вас здесь не было?
  - Нет, я вообще здесь в первый раз.
  - Можете сообщить что-то по поводу исчезновения вашего родственника?
  - Нет, не думаю.
  - Хорошо, спасибо. Господа, вот ваша техника, всех благодарим за понимание. Я хотел бы еще раз побеседовать с Ольгой Ильиничной и с Ариадной. А вы, господин Гаджиев, пожалуйста, оставайтесь здесь.
  Печальный юноша, очевидно, тот самый компьютерщик Эдуард, покорно уселся за стол и стал смотреть, как присутствующие разбирают свои вифоны. Марина, недовольно изогнув рот подковкой, тут же принялась возить пальцем по экрану.
  - Наталья Владимировна, - Вадим приподнялся, указывая ладонью на свободный стул.
  - Спасибо, Вадим Павлович, мне нужно идти, - докторша покосилась на свое отражение в буфетном стекле, заправила за ухо прядку, выбившуюся из прически. Была бы симпатичной, если бы не выражение лица. То, что русские не считают нужным улыбаться собеседнику, - общее место, но она выглядела слишком мрачно даже для русской. Не горе, не тревога за пациента, а именно неприязнь или отвращение. - До свидания.
  Вадим вышел ее проводить и сразу вернулся, как показалось Сергею, слегка смущенный. Следователь, тетя Ляля и Ариадна поднялись на второй этаж, компьютерный эксперт молча зашагал обратно в столовую. В руке он держал какой-то гаджет и не сводил с него глаз, будто на экранчике должно было появиться некое судьбоносное сообщение.
  - Эди, что случилось? - спросила мама, когда наверху закрыли дверь.
  - Он считает, я виноват. - Тенорок Эдуарда был чуть слышен.
  - Вы? В чем?
  - Он считает, ретранслятор подвис. И он говорит, это я сигнализацию вырубил.
  Мама сделала большие глаза. Вадим, возившийся со своим вифоном, негромко кашлянул.
  - Какой ретранслятор? - со склочными интонациями спросила Марина.
  Эдуард поднял на нее страдальческий взгляд и слабо всплеснул руками, будто разгоняя дым.
  - Нет, вы на меня не машите! Что за ретранслятор, что за сигнализация?
  - "Умный дом", наверное? - включился в обсуждение Виталий. - Не осталось записи, кто входил, кто выходил, так?
  Компьютерщик помотал головой, что могло означать и "нет, не в этом дело", и "не осталось, совсем не осталось". Потом встал и направился в столовую, где ходил эксперт со своим приборчиком. Сквозь дверную пленку слабо донесся его голос - кажется, он о чем-то спрашивал или оправдывался.
  - Он еще и Гаджиев, - прошипела Марина. - Из этих?
  - Он дагестанец, если ты это имела в виду, - флегматично отозвался Вадим.
  - Так он кого угодно мог впустить! Не при маме будь сказано. Эту козу - как ее, Машу? - или своих родичей из аула, или еще каких-нибудь бандитов!
  - Или всех сразу, - спокойно подвел итог Вадим.
  - Нет, а что ты хихикаешь?! - тут же вскипела Марина. - У него отец пропал, а он хихикает! Вить? Нина Георгиевна?
  - Правда, Вадим, тут дело серьезное, ты бы не шутил.
  - Не думал шутить. Но если бы вошел целый аул, это бы незамеченным не осталось, как вы считаете?
  - Да какой аул, - Нина Георгиевна уже давно собиралась что-то сказать, Сергей вспомнил, на чем их прервали, и повернулся к ней, выражая живейшее внимание. - Калитку он открыл!
  - Марин, тетя Нина, но зачем? - мягко, словно уговаривая детей, спросил Вадим. - Есть же современные способы связи. Если все так, как вы говорите, почему этой Маше или Даше было нужно лично приходить или присылать человека? Чтобы сделать романтическую сцену в реале? Простите, это несерьезно. И зачем ему было отключать сигнализацию, а врагу лезть через забор, если он или сам отец могли врага просто впустить?
  Нина Георгиевна отвернулась от него, всем видом показывая, что беседовать в таком тоне не намерена.
  - Ну, или он мог скрыть, когда ушел дядя Паша, - Марина не собиралась сдаваться. - Отредактировать протокол или, вот именно, подвесить всю систему.
  - А это зачем? Какая разница, полчаса туда-сюда.
  - Не согласен с вами, - не выдержал Сергей. Если бы ему дали точное время, когда дядюшка вышел из калитки, он бы знал, что делать дальше.
  - Хорошо, - сказал Вадим. - Но давайте рассуждать логически. Если человек вышел, если выход не отпечатался в протоколах "умного дома", и если система сбоила, подвисала, значит, время сбоя и есть то самое время. Ну, минуты вместо секунд, какая разница. Всего и толку, что парень попал под подозрение. И зачем бы он стал это делать нарочно? Я думаю, его обвиняют в халатности.
  - А тут согласен, - рассеянно сказал Сергей. Так-то оно так, но если видеокамера во дворе тоже завязана на "смартхоум" и, соответственно, изображение за эти минуты пропало, - это могло быть важное изображение. Романтическая сцена или нет, но более занимательная, нежели просто одинокий человек в старой куртке, идущий к калитке.
  
  ***
  
  Сергея поселили в мансарде под самой крышей, на третьем чердачном этаже. Свободных гостевых комнат не было: Нина Георгиевна занимала комнатку на первом этаже, за винтовой лестницей, Марина с Виталием, мама Сергея и Вадим жили на втором; Ариадну поместили там же, в родительской спальне, с тетей Лялей. Верхняя комнатка была просторная, с большим окном и двускатным потолком, обшитым деревянными планками, уютная, но холодная по зимнему времени. Столик с экраном имел какой-то странный разъем, а беспроводной связи не воспринимал вовсе, так что подключить к нему вифон не удалось. Еще наверху имелись тесная ванная комнатка и обширный чулан, откуда Сергей под руководством мамы выволок надувную кровать и нагреватель. В чулане пахло пылью, полынным маслом и меховыми воротниками, и чего там только не было. Полосатые выгоревшие шезлонги, сложенный разноцветный зонт с человека ростом, бумажные книги, древний, как в старых фильмах, компьютер или телевизор, коробки, коробки, коробки. На одной из коробок кто-то вывел зеленым маркером "игрушки". Интересно, от Ариадны они остались или, чем черт не шутит, от маленьких Паши и Нины...
  Свистел насос, кровать обретала пышные формы, нагреватель, как артист на эстраде, вертелся вправо-влево, испуская струи тепла. Сергей подошел к окну, окаймленному снегом. Белый круг стола был едва заметен на белом фоне. Ленту уже сняли, и по дорожке ползал маленький уборщик, отчищая щетками розоватые плиты. Белобрысый Хохлов уехал и забрал ботов, но компьютерный эксперт все еще терзал Эдуарда в подвале.
  "Умный дом", то есть смартхоум? Там дел на пять минут, и все трюки с замками и видеокамерами, на какие могут пуститься злоумышленники, давно известны. Если был сбой, ищи причины, а также, как верно было сказано, пиши в протокол время сбоя и пляши от него. Что за компьютеры у дядюшки, на обследование которых у эксперта уходит полный рабочий день? А для обслуживания требуется особый специалист, которого приглашают регулярно (Вадим сказал "компьютерщик отца"), которого немедленно позвали, когда дядя Паша исчез, и начали пугать...
  Хорошо или плохо нарушать приватность? Мать убьет. А мы ей не скажем. И вообще, в серьезном деле не до церемоний.
  Он вернулся в чулан. Точно: на полочке пластмассовый контейнер с надписью "копии счетов". Внутри оказались накопители, помеченные годами, позапрошлый - на последнем. Это действительно были счета: за электричество, за газ для готовки и отопления, за воду и канализацию, за Сеть... Характерная привычка русских - хранить экранные копии сообщений об оплате. Как ему объясняли, программное обеспечение коммунальных служб нередко ошибается по мелочам, и более чем в половине случаев - к выгоде государства, так что рачительные хозяева быстро привыкают все фиксировать сами.
  Пять лет назад обитатели коттеджа стали платить за электричество больше, чем раньше. Намного больше. Поиск в Сети показал, что цены в последние годы по России хотя и менялись, но не столь резко.
  Когда дядя Паша переехал на дачу и стал жить тут постоянно, даже зимой? Случайно не пять лет назад?
  На том же накопителе оказался короткий видеоролик, для разнообразия - трехлетней давности. Формат был странноватый, но распознался. В окошке возникла гостиная и дядюшка на низком стульчике у печки, там же, где утром сидел Вадим. Изображение было рваное и красноватое, похоже, снимали "глазом" вифона.
  - ...Гимн в честь чумы? - Прекрасно! - Браво, браво! - сказали за кадром мужские незнакомые голоса. Дядя Паша встал, провел рукой по седым кудрям и торжественно начал:
  
  - Когда могущая Зима,
  Как бодрый вождь, ведет сама
  На нас косматые дружины
  Своих морозов и снегов,-
  Навстречу ей трещат камины,
  И весел зимний жар пиров.
  
  Читал он хорошо, в классическом стиле, скандируя и возвышая голос в нужных местах. И сам хорош - благородно худощавый, ироническая складка у губ, голова поднята, будто он адресуется к невидимому слушателю позади всех и надо всеми. Интересно, среди гостей нет этой Маши? Хотя вряд ли... Судя по бряканью металла о фарфор, рядом с оператором кто-то ел, потом послышалось "ш-ш-ш", и бряканье стихло.
  
  Царица грозная, Чума
  Теперь идет на нас сама
  И льстится жатвою богатой;
  И к нам в окошко день и ночь
  Стучит могильною лопатой...
  Что делать нам? и чем помочь?
  
  Последняя строчка диссонировала со школой Малого театра, вопрос был задан обычным, разговорным тоном. Удачная находка - у Сергея аж мурашки побежали по предплечьям, и вовсе не от холода. Но дальше все пошло как положено, вакхически-весело:
  
  Как от проказницы Зимы,
  Запремся также от Чумы,
  Зажжем огни, нальем бокалы;
  Утопим весело умы
  И, заварив пиры да балы,
  Восславим царствие Чумы!..
  
  Чей-то смешок, клекотание вина, льющегося из бутылки. Сергей взглянул на таймер - времени в записи оставалось только-только дочитать стихотворение. Ладно, с этим все ясно, не до Пушкина сейчас. Надо еще посмотреть другой ролик - тот, который ему сбросила мама, датированный вчерашним вечером.
  Посиделки вчера снимали любительской флай-камерой. Она, как понял Сергей, реяла над праздничным столом и в шесть объективов делала круговую панораму. При просмотре эту панораму можно было поворачивать стрелочками и видеть любое лицо в любой момент.
  - Дорогие мои, спасибо вам всем. - Дядя Паша с высоким бокалом в руке, - раскраснелся, седые кудри вздыблены; поверх серого свитера повязан модный галстук, обозначая торжественность момента. - Спасибо, что навестили. Когда мой двор уединенный, печальным снегом занесенный... Ладно. Нинка! Наконец-то я тебя заполучил. Приезжай почаще, оставайся подольше...
  Сергей нажал паузу и закрутил панораму, отыскивая Нину Георгиевну, но тут же отвлекся.
  Этажом ниже разговаривали. Возле печной трубы, там, где она выходила из пола, было слышнее. Сергей узнал голос Марины - пронзительный, с характерными повышениями тона. Долгие паузы подсказывали, что она говорит по вифону.
  Не к чести Сергея, он не колебался вообще. Бросился на колени, выдернул из своего вифона "длинное ухо" и положил на пол. Штучка была полицейская и в принципе запрещенная к использованию в частной жизни. Умный гаджет присосался к дереву, запустил щупальце между досками, и в наушник пошел звук.
  - ...Не могли бы подождать? Мы обещаем... Послушай, у меня изменились обстоятельства. Муж моей мамы пропал, уже завели дело... Понимаешь, если его нет в живых, а на это очень похоже, мама его наследница... Да. Да. Сразу же, как смогу... Ну это уже ваше дело, насколько вы заинтересованы! ...Спасибо. И вам.
  Марина коротко выругалась и замолчала. Сергей поднялся и, стараясь ступать на всю ногу, чтобы не скрипнули доски, пошел к лестнице.
  На втором этаже никого не было, или же все молча сидели по комнатам. Гостиная внизу тоже опустела: в печи потрескивали дрова, за окном кружились снежинки, но тучи редели, и небо наливалось светом. Сергей прошел в столовую, она же кухня. Что тут проверял компьютерщик? Все как у людей: массивный обеденный стол с лакированными ножками-бутылочками, хозяйственный стол с бытовой техникой, на стене над ним висят разделочные доски и прочие поварешки, на потолке вентиляционные трубы, в углах всякие полезные вещи вроде противопожарного датчика дыма и сетевого ретранслятора... Сергей прислушался, не идет ли кто, пододвинул табуретку и влез на нее. Ретранслятор был дорогой, мощный, приспособленный для перекачивания больших объемов информации.
  Он постарался припомнить, как звучали шаги, перед тем как следователь, эксперт и Эд с Натальей Владимировной вошли в гостиную. Припомнил и повернул налево. Там оказалась лесенка, ведущая вниз, и незапертая дверь.
  В подвале было светлее, чем наверху, - светился весь потолок. Сергей уже не удивился, увидев стеллажи с компьютерным железом. Какой к чертям "смартхоум", тут небольшой аналитический центр... За стеллажами бубнили о каких-то протоколах, о том, что какое-то время совпадает или не совпадает... Обойдя стеллажи, Сергей увидел двоих за терминалом: Эд обернулся к нему с непонятной отчаянной надеждой, а усатый эксперт сказал "здравствуйте", причем Сергею явственно послышалось "зачем приперся?"
  - Прошу прощения, тут где-то должен быть чулан. Мне сказали взять одеяло, в мансарде холодно.
  - Тут барышня уже искала чулан, - неприветливо сообщил эксперт. - Это точно не здесь, посмотрите наверху.
  - Барышня?
  - Вы нам мешаете, до свидания.
  Не слишком любезно, но заслуженно, сам бы в процессе работы ответил постороннему примерно так. Согласно нормам московского этикета, Марину можно было назвать барышней. Маму с тетей - уже нет, и конечно, не Нину Георгиевну, а Марину вполне...
  Нина Георгиевна, легка на помине, оказалась на кухне - наливала себе чай из заварочного чайника. Рядом стояло блюдечко с яблочными чипсами, диетический перекус разумной женщины. Значит, подробный осмотр ретранслятора придется отложить. А с другой стороны, есть вещи и поважнее.
  - Нина Георгиевна, вы как себя чувствуете?
  Она взглянула на него слегка удивленно - в точности так смотрел дядюшка поверх своих узеньких очков.
  - Спасибо, Сережа, я в порядке. Конечно, в расстроенных чувствах, но не как Лялечка. Должен же кто-то сохранять присутствие духа.
  - Я могу вам чем-нибудь помочь?
  - Чем тут поможешь, - грубовато ответила старая дама, но улыбнулась. Сергей тут же налил и себе чаю, включил тостер и присел напротив. - Если бы люди вели себя как следует... но этого мы с вами обеспечить не можем, верно?
  - Вы про дядю Пашу?
  - И про него тоже. Сереженька, мужчине пятьдесят три года, как можно быть таким дураком, не понимаю. Не все люди хорошие, не всем можно верить, это раз. И надо уметь ценить то, что дает тебе жизнь, это два. Собственный дом, любящая жена, прекрасная дочка. Что имеем, не храним, потерявши плачем.
  Она покачала головой так сурово, будто это Сергей голышом убежал от любящей жены. Была ли семья у самой Нины Георгиевны? Кажется, нет, ни семьи, ни детей, свободная женщина лет шестидесяти, университетский профессор в отставке. И собственного коттеджа, наверное, нет.
  - Я все время думаю про Алю, - признался он. - Она так испугалась.
  - Вот и я не понимаю, как можно было не пожалеть девочку, - при этих словах Нина Георгиевна оглянулась через плечо, и Сергей ощутил знакомый импульс, будто внутренние часы высветили напоминалку. Свидетелю есть что сказать, и он скажет, если правильно спросить.
  - Мне казалось, дядя Паша очень ее любит, - на пробу произнес он.
  - Мне тоже так казалось, - она отхлебнула из чашки и снова покачала головой, скорбно поджав губы.
  - Как же он мог не оставить сообщения?
  - А я вот думаю, он сказал кому-то. И этот кто-то знает, но молчит.
  - Кто, по-вашему?
  - Точно я не знаю, но думаю на этого Гаджиева.
  - А он здесь был и вчера? (Нина Геннадьевна значительно наклонила голову.) Вы считаете, он знает, где дядя?
  Еще кивок.
  - Почему?
  - Я видела следы утром.
  - Что за следы?
  - Следы от поленницы за домом - слева от входа, Паша туда за дровами ходил. Следы вели оттуда, мимо двери и через двор к калитке. Шли двое. Я еще подумала: кто это уехал так рано?
  - Рано?
  - Было восемь утра, полдевятого. - Заметив его удивление, Нина Георгиевна пояснила: - Я по утрам бегаю на лыжах, здесь лыжня у леса, в поселке многие катаются. Так вот, возвращаюсь, а тут следы. А как раз шел снежок, все, что вчера натоптали, замел. Эти следы были свежие.
  - От какой обуви, не заметили? - привычно спросил Сергей.
  - От валенок, мы тут все по двору ходим в валенках. И те, и другие следы от валенок. Значит, Пашка так в валенках и ушел...
  Валенки. Безразмерная обувь, округлая подошва, и сверху еще присыпало рыхлым снежком. Сумели боты найти эти пятна плотности или нет?..
  - Да, и при этом двое шли к калитке, и потом один вернулся. Уже по дорожке, от калитки к дверям.
  Двое прошли к калитке, один ушел, один вернулся. Наутро в доме были все, кроме дяди. Значит, кто-то из тех, кто остался в доме, его проводил. Если исключить вариант с таинственным пришельцем, скрывающимся в котельной и не найденным опергруппой, остаются мама, тетя Ляля, Марина и Виталий, Вадим, Эдуард. И сама Нина Георгиевна, не будем забывать об этом варианте, кстати, разговоры о следах могут быть и враньем...
  - Но причем тут тогда сигнализация? - спросил он. - Калитку изнутри мог открыть любой из тех, кто был в доме, и сигнализацию отключать не потребовалось бы.
  - А это вообще ни при чем. Я теперь вспомнила: вчера сработала пожарная сигнализация, ее выключили и, наверное, потом забыли включить. Вот полиция и прицепилась не к тому, к чему надо.
  - А вы никому не сказали про следы?
  - Почему же, сказала этому, - Нина Георгиевна хлопнула себя правой рукой по левому плечу, обозначив погон. - Надеюсь, он все правильно записал. Ни Ляле, ни Маринке с Вадькой не сказала.
  - Вы предполагаете, кто-то из них может быть замешан?
  - Хм... Насчет мадам Югановой не удивлюсь. Она Пашу никогда не любила, а деньги ей нужны. Ляля ей даст любую сумму, родная кровь. И смотрите, как она показывает свою нелюбовь к этому Эдуарду, прямо вся шипит. Демонстративно.
  - А тогда почему вы считаете, что замешан Эдуард? Могли быть и ее следы во дворе.
  Собеседница посмотрела на него с сожалением.
  - Потому что Пашка ее тоже не любит, и есть за что. Да хоть бы и любил, не стал бы он с дочкой жены от первого брака обсуждать интимные секреты. С мужем ее тем более не стал бы. А этот Эдуард ему как родной, он часами с ним сидит за компьютером, смеются что-то, никого не пускают. Может, его Звягинцева подкупила, а может, и Маринка. А может, они обе в сговоре.
  - Как насчет Вадима?
  - А ему нет смысла отца втягивать в развод, - по быстроте ответа видно было, что над этим Нина Георгиевна уже подумала. - Он на этом потеряет. Если бы он узнал, он бы не провожал его, а удерживал. Вот ему бы я сказала, но вы видели, Сереженька, как он со мной разговаривает. И вы ему не говорите, пожалуйста.
  - А нам с мамой вы доверяете? - Сергей выдал самую обаятельную свою улыбку.
  - Представьте, доверяю, - она тоже улыбнулась, но продолжила серьезно. - Вы оба недавно приехали, материальной заинтересованности у вас никакой, а чтобы Аня предала сестру просто так, по бабской злобе, я не верю. Не такой она человек.
  Все верно, думал Сергей, возвращая комплименты. Если причина на самом деле в женщине. А это-то пока и неочевидно...
  
  ***
  
  Посмотреть ролик опять не вышло: постучалась мама и велела сопроводить ее в поселковый супермаркет. Доставку продуктов на сегодня никто не заказал, нужно было что-нибудь выбрать к обеду, а делать это с вифона доктор Островски не хотела, не доверяя российским презентациям товара.
  - Пельмени - это только с мясом, - поучала мама, пока они шли вдоль снежных насыпей, мерцающих солнечными искрами. - С любой другой начинкой - вареники. Запоминай, чтоб не опозориться. На мужчин возьмем пельменей, Ляльке вареников с вишней, она их любит, может, поест, на нее страшно смотреть. Нина Георгиевна вегетарианка, ей с картошкой и грибами...
  Супермаркет оказался вполне столичного вида, с быстрой выдачей. Переложив пакеты из корзины в машину доставки, Сергей взял маму под руку.
  - Пойдем, посидим в кафе.
  - Ты что? А обед?
  - Мам, дома, кроме тети Ляли, две взрослых женщины и Алька, найдется кому посолить и бросить в кипяток. А мы по кофейку. Хочешь, угощу тебя ристретто?
  - Тут нет ристретто.
  - Кто сказал "нет"? Квадратик справа, расширенное меню, все как у нас. Давай. Взрослый преуспевающий сын платит.
  Доктор Анна Островски внимательно взглянула на преуспевающего сына. Действительно, они были очень похожи.
  - Ну, говори, чего тебе надо.
  - Мне хотелось бы, чтобы ты мне объяснила: чего я не знаю про дядю Пашу?
  Мама фыркнула. Взяла из ниши на столике кофе и кувшинчик со сливками, бросила обратно капсулу с сахаром и только потом ответила.
  - Про дядю Пашу ты не знаешь много такого, чего тебе не следует знать. Что тебя интересует?
  - Например, почему полиция приехала сразу.
  - Тебе это не нравится?:
  - Нет, я просто не понимаю: в России дело о пропаже взрослого человека всегда возбуждают через часы после факта пропажи?
  - Почему нет? Думаешь, только в Америке соблюдают закон?
  - Но, значит, есть веские причины полагать, что он не сам ушел, по собственной воле?
  - Нет причин полагать, что он мог уйти без вещей и одежды, никому ничего не сказав, и бесследно исчезнуть. По закону этого достаточно.
  - Он мог сесть в машину. Но ладно, допустим. А почему тетя Ляля так убивается... как по покойнику?
  - Типун тебе на язык. У нее муж пропал.
  - Пропал - не умер. У нее же такой вид, будто случилось непоправимое.
  - Психолог ты мой полицейский, - снисходительно сказала мама. - Она любит его.
  Кажется, тайна охранялась строже, чем он думал. Сергей взял свой кофе и заговорил сам.
  - Хорошо. Тогда я расскажу, что я знаю. Павел Георгиевич переехал на дачу пять лет назад и с тех пор жил тут практически безвыездно. Тетя Ляля ездит и в Москву, и у тебя в гостях была, он - нет. Даже когда Ариадну награждали за победу на олимпиаде, не приехал на церемонию. Тогда же, пять лет назад, в подвале установили компьютерное обеспечение, нестандартное, энергоемкое и далеко-далеко за пределами бытовых нужд... Только не спорь, я его видел. Это не "смартхоум", это нечто намного более сложное. К оборудованию следствие проявляет живой интерес, как и к дядиному компьютерщику. Который, кстати, вчера был на дне рождения, куда пригласили только близких родственников.
  - А по-твоему, его надо было выставить? - не выдержала мама. - Мы на стол накрываем, а вы идите себе, вы обслуживающий персонал, а у нас семейный праздник? Милый, в Москве приличные люди так не поступают.
  - А потом он остался ночевать.
  - Да, а что такого? Он и раньше тут ночевал, когда они с Пашей засиживались.
  - В подвале.
  - В подвале, а что тебя так волнует?!
  - Нет, ничего. Идем дальше. После дня рождения дядя внезапно уходит из дома. И не исключено, что при сем присутствовал кто-то. Кто-то из своих. Проводил хозяина и теперь молчит. - И Сергей рассказал о следах.
  Рассказ на маму подействовал. Она допила кофе залпом, забыв про сливки, и сжала губы.
  - Ты не предполагаешь, кто это мог быть?
  - Нет. Нет. Проснулась я не рано, к окну не подходила.
  - Шагов не слышала?
  - Слышала. Кто-то ходил в ванную, она рядом со мной, потом спускался по лестнице, я подумала - Паша за дровами... Вот теперь мне кажется, что я слышала еще чьи-то шаги, как будто кто-то потом спустился за ним.
  - Но если Эдуард ночевал в подвале, то, значит, это не он?
  - Я не уверена даже, что это были шаги на лестнице. Кто же знал, что надо было прислушиваться. Может быть, Нина внизу ходила со своими лыжами. Теперь говори, к чему ты клонишь.
  - Я думаю, Павел Георгиевич занимался чем-то опасным, - сказал Сергей. - Надеюсь, что это не криминал, а секретные исследования... хотя, если подумать, одно другого стоит. Я также думаю, что кто-то заинтересован в том, чтобы эти его занятия прервать. А кто-то из тех, кто сейчас будет есть пельмени и вареники, вошел в долю. При любом варианте дело очень нехорошее. Если ты что-то знаешь, скажи мне, пожалуйста.
  Мама опустила глаза, пальцы ее крутили ложку из мягкого пластика, скатывая в трубочку.
  - Если я тебе не скажу, ты будешь и дальше болтать об этом, пока не дойдет до Альки, - наконец сказала она. Сергей промолчал. - Ну ладно. Но это не должно пойти дальше.
  - Мамочка, ты не представляешь, сколько страшных тайн хранится в этой голове.
  Она не улыбнулась в ответ.
  - У Паши болезнь Чена, вторая стадия. Нейродегенерация по типу Альцгеймера.
  - Ч-что? В каком смысле?
  Чего угодно он ожидал, но не этого.
  - Мам, я не понимаю, как это - вторая стадия? Я же видел его записи, интервью "Науке-Пресс"! Говорил с ним по вифону! Абсолютно нормальный человек, речь, память, контакт с собеседником. Стихи читает...
  Мама кивала в такт его аргументам.
  - Да-а, стихи наизусть, печку топит и даже пишет обзорные статьи. Ты знаешь, что такое когнитивный протез?
  - Эти штучки, которые склеротики носят на висках? Знаю, конечно. Кстати, память идеальная становится, лучше, чем у здоровых, хотел бы я в каждом деле иметь по такому свидетелю. Но ведь у дяди Паши их нет?
  - Штучек на висках нет, - подтвердила мама, - а электродная сетка под скальпом есть. Обычно у пациентов бывают видны антенны - такие блестящие волоски, - но не в Пашкиной гриве. Управляющую часть ты видел в подвале. Когда процесс охватывает обширные зоны коры, штучками не обойтись. Ретрансляторы и точки доступа в доме на стенах и потолке, плюс несколько снаружи, во дворе. Пашин когнитивный протез - весь коттедж. Пока он дома, его мозг работает нормально.
  Сергей потряс головой.
  - Мам, еще раз, с начала, для альтернативно умных. Что с ним, зачем электроды, антенны?
  Мама вздохнула и заговорила, глядя перед собой.
  - Хорошо, сначала. Болезнь Чена - коннектопатия. Нервные клетки не погибают, но идет дегенерация синапсов, контактов между ними. Разрушаются связи между участками коры. Если не лечить, результат тот же: распад личности, превращение в человекообразный овощ. Но в отличие от многих других нейродегенеративных заболеваний, коннектопатии поддаются аппаратной коррекции. Если принимать сигналы от одних зон и перенаправлять их на другие, то мозг работает нормально.
  - Так. А компьютер зачем?
  - Сережка! - мама усмехнулась. - Ты думаешь, достаточно протянуть проволочки вместо нервных окончаний? Если повреждения обширные, выход по входу рассчитать не так просто, для пересчета паттернов активности нужны специальные программы, вычислительные мощности. Это сделали ребята из Питера, они публикуются помаленьку. Я читала - не совсем моя область, но высокий класс, безотносительно к тому, что это Лялькин муж. Нехорошо так говорить, а небось, ждут не дождутся, когда Паши не станет и можно будет раскрыть анонимность пациента. Знаменитый физик после страшного диагноза прожил полностью сохранным... Что? Что ты на меня так уставился?
  - Ждут не дождутся?
  Мама всплеснула руками.
  - Это у тебя вместо башки полицейский компьютер, - перегнувшись через столик, она постучала Сергея пальцем по лбу. - Даже и не думай! Я с ними пересекалась. Они врачи. Сперва врачи, а потом уже грантодержатели.
  - Хм-м...
  - Ладно, вот тебе аргумент в твоем вкусе: ни один ученый не прервет уникальный эксперимент, потому что чем дольше он идет и благополучнее закончится, тем больше им славы. Возможно, их бы устроило, если бы Пашка умер от язвы, пневмонии, с лестницы бы упал - от чего-то совсем не связанного с мозгами. Но похищать его они бы не стали, даже если бы им понадобилась суперсрочная пиар-кампания. Результат будет такой, что пиар-кампания не получится.
  - Какой будет результат?
  - При выходе из поля немедленное ослабление рассудка, говоря по-простому. Может быть, не овощ, но младенец или... в общем, мало веселого. А с течением времени вероятны необратимые повреждения, которые уже нельзя скорректировать.
  - Через какое время?
  - Точно не скажу. Попробуй узнать, я при Ляльке не могу. Сама она, наверное, знает, но я боюсь ее спрашивать.
  - М-да, вот тебе и ни фига себе, - Сергей машинально повторил Алькино выражение. - Я должен это обдумать... Погоди, еще вопрос: кто об этом знает? О болезни, о когнитивном протезе?
  - Лялька знает. Я знаю - она мне позвонила сразу, как поставили диагноз. Вадим. Эд, естественно, - это его работа. Наташа Лебедева, наблюдающий врач, очень милая женщина, ты ее видел. Врачи, нейрофизиологи, нейрокомпьютерщики - участники проекта, но все они в Санкт-Петербурге. Двое Пашиных друзей, один, кстати, живет тут, в поселке. Больше никто, по идее, не знает. И не должен знать.
  - Так. А в чем обвиняют Эдуарда?
  - А ты как думаешь?! Паша не ушел бы из дома добровольно, Нинины сказочки про женщину - ерунда. Нет таких причин, которые могли бы его заставить. Значит, связь оборвалась. После чего этот гад просто взял его за руку и...
  - И вывел из калитки, там дядю Пашу кто-то встретил и увез, а этот вернулся, - закончил Сергей.
  Вот почему у всех собирали вифоны. Сообщник.
  - Но прервать передачу мог кто угодно. Эти точки доступа даже я приметил, и большого ума тут не требуется, в Сети полно пошаговых инструкций... Или они как-то защищены?
  - Насколько я знаю, нет. Только частота другая, чем у нормальных бытовых устройств, и мощность побольше, чтобы стены не глушили - ты видел, дом деревянный. Дело в другом. Если комп перестает принимать сигналы от мозга, он должен включить сигнал тревоги. В подвале и у Ляли на браслете - заметил, она его и сейчас не снимает? Незаметно выйти из зоны приема Паша не мог.
  - А, так вот что за сигнализация! - Сергей стукнул себя по лбу. - Ретранслятор подвис, и сигнализация не сработала... Если она не сработала, тогда плохи дела Эдуарда. Но ты все равно думаешь, что он не виноват?
  Никогда раньше мама на него так не смотрела, но этот взгляд был ему знаком. Так смотрят свидетели, когда расскажут все, в ожидании немедленного торжества справедливости.
  - Я не знаю. Мне казалось, он Пашку по-своему любил. И потом...
  - Что потом?
  - Нет, я понимаю, это не аргумент, но представь себе - по сути, он пять лет занимался техническим обслуживанием его мозга. Нельзя же предать человека, который так от тебя зависит?.. Ну хорошо, я не разбираюсь в вашим детективных делах, сужу по книжкам. Но ведь в книжках самый подозрительный не бывает виноват? Не идиот же он?
  - Не идиот. Но в жизни бывает по-разному. Например, он мог взять всю вину на себя, а кто-то ему что-то за это обещал...
  Кто-то. Сестра, родной сын, дочка жены, ее муж... Милая картина. Теперь понятно, почему доктор Наташа после беседы со следователем вышла такая злая.
  - А тетя Ляля? Она подозревает кого-нибудь?
  - Она думает, что это Нина. Знаешь, одинокие женщины, которые ни от кого не зависят и всего добились сами... Мне кажется, она завидовала младшему брату. Ну не то чтобы завидовала, но считала, что ему повезло не по заслугам.
  - Но не до такой же степени, чтобы...
  - Все может быть.
  
  ***
  
  Чердачная комната прогрелась, и резиновая шкура кровати уже не была ледяной, как сугроб. Можно лечь и уставиться в потолок, где, кстати, тоже прикреплена точка доступа. Мало ли, вдруг хозяину захочется слазить в чулан, посмотреть детские игрушки, какие-нибудь бумажные книги, старые керосиновые лампы... Что же, ведь веком раньше многие люди не имели возможности покинуть дом или больничную палату, и Сети не было. А тут можно даже выйти во двор весенним вечером, увидеть сосну, цветущие яблони. Тысячи сигналов, цифровой образ сосны, яблони, светлого неба невидимыми молниями срываются с металлических волосков в седой шевелюре, и несутся в дом, в подвал, а там расчетные программы работают, и сигнал летит назад, к хозяину, возвращает слова "сосна" и "яблоня", "иглы" и "бутоны", воспоминание о других вечерах и вёснах...
  Отставить эмоции, Островски. Этические и эстетические аспекты обдумаем потом. После того, как найдем дядю Пашу.
  ...За обедом тетя Ляля тихим невыразительным голосом попросила всех задержаться до завтра, благо день выходной, и не оставлять ее. Говорила она почти умоляюще и не оставила гостям возможности отказаться. Вадим сразу заверил, что и не собирался ехать сегодня, и в понедельник после работы может вернуться сюда. Нина Георгиевна сказала, что Ляля слишком трагично все воспринимает, но лично она, как пенсионерка, никуда не торопится, и если ее присутствие не обременит... Виталий и Марина выглядели недовольными, но промолчали.
  После обеда мама шепнула ему, чтобы он зашел к тете в комнату. Альку сестрички выгнали без особой деликатности.
  - Сереженька, я рада, что Аня тебе все рассказала. - Тетя Ляля говорила, будто боролась со сном, да, наверное, так и было - сестра и дочь напоили ее всякими травками. - Ты детектив, найди мне того, кто это сделал. Того или ту, как у вас в Америке говорят. Можешь убить, если придется. Ты убивал там, у себя на службе?.. Не отвечай. Только пусть она отдаст Пашу, нельзя же так, это мерзко. Заставь ее рассказать...
  Тетя Ляля в самом деле была уверена, что похищение устроила Нина Георгиевна. Версия как версия, ничем не хуже остальных.
  Возможные мотивы. Деньги? Идентификатор у дядюшки был, был и доступ к счетам - мама еще раньше обмолвилась, что он самостоятельно делал заказы по Сети, да и прожил ведь он один тот месяц, когда тетя Ляля гостила у мамы. И уж наверное, не было такого ограничения, чтобы идентификатор действовал только на одном компьютере, коль скоро открытой информации о недееспособности владельца нет... Хотя чепуха: теперь-то, когда дядюшка в розыске, его чипом не снимешь ни цента, то есть ни копейки. Да и как он будет выполнять подтверждение, если он не в разуме?
  А если похитители не знали о его болезни? Подвели к калитке обманом, или же он подошел сам (не торопимся верить истории о следах двух человек, пожилая дама явно недолюбливает многих родственников, если не сама она участница этого дела). Звонок из службы доставки, от соседа, от друга, поговорить на минуту, а там скрутили, увезли, на соседней улице получили сюрприз, перепугались... Нет, не сходится. Если бы они не знали, то не отключили бы тревожную сигнализацию.
  Другой способ получения денег - наследство, если дядюшка будет найден мертвым или окончательно недееспособным. Кто может быть упомянут в завещании? Тетя Ляля, Алька, Вадим, Нина Георгиевна. Марина с супругом - вряд ли, но Марине, как верно заметила тетушка, даст денег мать. Итого - все присутствующие, кроме мамы и Эдуарда. Эдуарду финансовой выгоды от смерти Павла Георгиевича вроде бы нет - скорее всего, наоборот, работа у него престижная и хорошо оплачиваемая.
  Насколько деньги были нужны каждому из родственников? Это можно было вычислить, используя открытые сетевые источники, и Сергей этим занялся. Финансовое положение Вадима подозрений не вызывало - он был инженером-конструктором в частной космической компании, явно пользовался авторитетом в профессиональном сообществе. Тетя Нина, вероятно, была небогата, но имела квартиру, профессорскую пенсию и бесплатную медицинскую страховку. Насколько можно было судить по темам бесед в Сети, денежные вопросы ее не волновали. А вот о Виталии и Марине Югановых этого сказать было нельзя. Сергей теперь понимал, что за разговор он подслушал.
  Далее: возможности. Они как будто имеются у всех. Эдуард мог просто вырубить передачу, сигнализацию, а заодно и видеокамеру, вывести дядю Пашу и спокойно вернуться. Но то же самое мог сделать и любой, кто был в курсе. А быть в курсе мог и тот, кто прикидывается незнающим.
  И еще один момент: сообщник или сообщники. Кто-то должен был увезти дядюшку отсюда. Скорее, именно увезти, а не увести за руку, рискуя попасться на глаза свидетелям, - улица освещена фонарями. А значит, тот, кто затеял похищение, должен был дать знать сообщнику, что можно подъезжать...
  Ладно, об этом думать рано. А взглянем-ка мы на точки доступа.
  
  ***
  
  В воздухе пахло снегом и печным дымом. Было удивительно тихо, шоссе вдалеке гудело на грани слышимости. Небо стало ясным, и пуховая пелена, укрывшая лужайку и сугробы вокруг нее, сквозила розоватым светом. По сосновому стволу вниз головой сбежала белка в серой шубке с красными отворотами, замерла на такой высоте, чтобы рукой ее не достать. Смешные выпуклые глазки оглядели Сергея: какой пришел человек, из тех ли, что подают белкам семечки на ладони, или, наоборот, он сам может белку схватить и съесть? Не увидев подачки, приняла вторую версию как рабочую - развернулась легким прыжком и дунула вверх.
  Сергей прошелся по дорожке вдоль дома. Точка доступа во дворе была не одна: только на стене раз, два, три... Он поднял вифон и включил зум. Нет, это видеокамера. Две точки, а за углом еще три и четыре. Расположены на высоте не менее трех метров от земли, незаметно к ним не подобраться. Да еще ко всем. А если вырубить одну, остается риск, что жертва войдет в зону действия другой и очнется...
  Он вывел на экран план дома. Поставил точки, задал вокруг них круги. Побрел по дорожке, глядя себе в руку, и вдруг услышал голоса.
  - ...А какие модули для этого нужны?
  - Давайте посмотрим, Алечка. Какие модули для этого вам нужны?
  - Вы хотите, чтобы я сказала?! Ксо! Ну ладно, сейчас подумаю...
  Говорили на лужайке за кустами. Эдуард и Аля забрались с ногами на заснеженную скамейку и сидели на ее спинке. На Ариадне была круглая шапочка из рыжего полимерного меха, и она в кои веки походила на хорошенькую девочку, а не на беспризорника после вошебойки. Оранжевая мягкая куртка тоже очень ей шла. А вот Эдуардова пунцовая "африканка", блестевшая, будто ломаное стекло, рядом выглядела странно. Айтишник, способный управлять человеческим мозгом, даже знать не должен, где продается такая дешевка, - одежду эконом-класса покупают в эконом-местах. Отрыл здесь, в каком-нибудь чулане?.. Однако Сергей припомнил, что и брюки, и теплая рубаха Эдуарда выглядели дешево. Настолько же, насколько дорого одевались супруги Югановы, - на грани приличия.
  Но теперь он был куда менее несчастным. Ариадна, водя пальцем по экранчику, что-то говорила о библиотеках функций, о срезах и списках, - ей явно нравилось, что ее слушает настоящий взрослый. А Эдуард и в самом деле слушал, внимательно и серьезно. И еще это расстояние между ними, будто невидимая стена, в которую упираются его плечо и локоть.
  Сергей осторожно отступил назад и вернулся в дом.
  
  
  Кухня и столовая были пусты. Сергей обошел помещения, поднял глаза на ретранслятор. Этот, должно быть, обслуживает ближайшие точки доступа в помещениях, а также во дворе, по ту сторону стены. Если вмешательство было не программное, то лучшей мишени не найти. Этот и еще тот, что в холле.
  Антенна - горизонтальный стерженек длиной в мизинец. Дел на секунду: как только хозяин выйдет во двор, взять кусок металлической фольги, облепить антенну, слегка обмять, чтобы держалась... Кстати, вон и она, фольга для запекания, рулон висит над плитой. Край оборван ровно, но это ни о чем не говорит. А вот если скомканную металлическую фольгу второпях срывали с антенны...
  Он снова влез на табуретку, включил в вифоне фонарик, в объективе макро. Балансируя на цыпочках, осмотрел серый стерженек. Слабый пыльно-жировой налет, засохшая бурая капля. Свежих царапин нет. Несвежих, впрочем, тоже.
  Едем дальше. Здесь у нас кухонные приборы, которыми может пользоваться любой желающий. Увы, Сергей мало разбирался в кухонной технике. Старинный механический измельчитель для пряностей. Кофе-машина. Кухонный комбайн... Ха!
  Серый ящик с дверцей на полке, в метре наискосок вниз от ретранслятора. Микроволновая печь. Старая модель, без дополнительных функций, бутерброд разогреть.
  Как раз то, что нужно хозяину дома, который встал затопить печь и не хочет беспокоить женщин.
  Сергею представился дядя Паша в меховой безрукавке, как он выходит в темную кухню, ранним зимним утром, похожим на ночь. Включает лампочку над столом, тыкает пальцем в кнопку кофеварки, вытаскивает из пакета ломоть хлеба, кладет на него кружочек колбасы, квадратик сыра, и вот на этой стеклянной тарелке ставит в серый ящик, защелкивает дверцу, поворачивает таймер, и дальше - пустота, бессмысленный взгляд в одну точку, и кто-то протягивает руку из-за спины, поворачивает таймер на полчаса... Бутерброд сгорит.
  Ладно, можно без драматизма. Кто-то дожидается, пока дядя Паша выйдет во двор, и включает микроволновку. Предварительно повредив защитный слой, или, скажем, уплотнитель под дверцей, чтобы выпустить излучение.
  Повреждений не обнаружилось. Зато блокировка включения с открытой дверцей тут совсем примитивная. Если сунуть зубочистки сюда и сюда...
  - Что вы ищете?
  Виталий смотрел на него поджав губы, как какой-нибудь английский герцог на лакея, ворующего марочный портвейн.
  - Интересный прибор, - Сергей лучезарно, на американский манер улыбнулся. - Никогда раньше не видел. Микроволновка, так, кажется?
  - Конечно, не видели. В Америке на кухнях только суперботы.
  - Я вас не понял? - Вежливый способ сказать "парень, мне не нравится, как ты разговариваешь".
  Виталий сел за стол. Держался он прямо, будто аршин проглотил, и лицо у него было недовольное.
  - Я нашел информацию о вас в Сети, - сообщил он. - Вы полицейский.
  - Информация, которую вы нашли, устарела, - в тон ему ответил Сергей. - Я частный детектив. В этом нет ничего особенного, у многих есть профессия и место работы.
  Щека у Виталия дернулась.
  - Я видел, как вы бродили вокруг дома, и вот что хочу вам сказать. Не надо устраивать тут игры в Шерлока Холмса. У матери моей жены большое горе, и нам не нужны самозваные сыщики. Следствие ведет местная полиция, вас это дело ни в коей мере не касается.
  - Уж будто? - Сергей сел напротив и прищурился ему в лицо. - А ничего, что мать вашей жены - это сестра моей мамы?
  - Тем более могли бы пожалеть ее и вести себя прилично, не вынюхивать тут... не знаю что.
  - Я очень жалею тетю Лялю, - сказал Сергей.
  - Проявляйте свою жалость как-нибудь иначе!
  - Странный разговор у нас с вами получается, - Сергей пододвинул себе корзинку с печеньем. - Вы решили, что я пытаюсь вести расследование собственными силами. Только потому, что я гулял во дворе, а потом открыл дверцу печки. Вы так уверены, что тут есть что вынюхивать? (Виталий промолчал.) Признаюсь, я не вижу ничего невероятного в том, о чем говорила Нина Георгиевна - ну, про все эти поздние любови... Печальная ситуация, неловкая, но более чем возможная. А у вас другое мнение?
  - Не пытайтесь сбить меня с толку! - Виталий покраснел, возможно, ему было жарко в пуловере. - Видел я, как вы гуляли, - через каждые три шага целились вифоном в дом. Я прошу вас это прекратить.
  - Хорошо, - со всей доступной ему кротостью ответил Сергей. - Считайте, что уже прекратил.
  Искать информацию в Сети он мог бы поучить Виталия. Уже полчаса как он знал, что Максим Витальевич Юганов учится на втором курсе колледжа "Заречье-Инновация". На платном отделении. В отличие от Ариадны, победителем олимпиад он не был. Знал Сергей также, в какие суммы это обходится любящим родителям - Кембридж, хоть британский, хоть тот, что в штате Массачусетс, вышел бы дешевле. И еще примечательный факт: хотя Виталий Степанович Юганов в своем блоге фигурировал как топ-менеджер некоей крупной компании (и судя по всему, действительно был им), в актуальном списке сотрудников на сайте компании он не числился. Не лучшая ситуация для получения кредита на элитное образование.
  - Извините, я еще хотел спросить: вон та штучка на стене - она зачем? Какие-то проблемы с Сетью?
  Виталий скосил глаза на стену.
  - Где?.. Не знаю, - кисло сказал он. - У меня все ловится. Это, может быть, от старого времени осталось, когда сигнал был слабый... хотя не знаю. Вам не все равно?
  Что ж, реакция выглядит правильной: если бы он сразу понял, какая штучка и почему я спрашиваю, не искал бы ее глазами. К тому же разъярился, начал бы снова требовать, чтобы я прекратил вынюхивать, или, наоборот, сыграл бы безразличие. Но так сыграть вялое раздражение от американского родича и его дурацких вопросов...
  Кто-то спустился по лестнице, и через минуту в кухню вошел Вадим.
  - Привет всем. Как насчет по пятьдесят, пока наши дамы у себя? Я что-то неважно себя чувствую.
  Он и выглядел неважно, под глазами набрякли мешки, и движения замедлились, словно после тяжелой работы. Этому спокойному ироничному человеку было скверно, и ему не с кем было поговорить о случившемся. По-настоящему поговорить, с кем-то, кто знает их маленькую семейную тайну.
  - Хорошая мысль! - сказал Сергей. - А есть?
  - А как же не быть, - Вадим взял из холодильника монументальную бутыль с сине-радужной этикеткой и упаковку колбасы. - Вот, доставайте, хлебушек там, а я посуду возьму.
  Сергей порезал скобками мягкий ржаной хлеб, ножом изобразил перекрестье на кругах колбасы. Унылая физиономия Виталия просветлела. Вадим в это время рылся на полке буфета - вытащил стаканчики, придирчиво заглянул в них, поставил обратно и взял другие. Судя по тяжести и маслянистому блеску, серебряные, украшенные графитово-черным орнаментом, и на ножках с подставками, словно маленькие кубки. Точно, серебро, - Сергей сразу почувствовал пальцами холод, когда взял наполненную рюмку.
  - За отца, чтоб он скорей вернулся, - сказал Вадим. Сергей и Виталий мужественным бормотанием подтвердили тост.
  - Интересные стопочки.
  - Кубачи, - непонятно пояснил Вадим. - Папа говорит, из них водка вкуснее.
  - Павел Георгиевич увлекался дагестанской культурой, - заметил Виталий. - Возможно, зря.
  Рука Вадима, лежащая на столе, сжалась в кулак.
  - Папа не увлекается дагестанской культурой, - говорил он спокойно, лишь слегка выделил голосом глагол в настоящем времени, и даже сквозь заросли бороды было видно, как побагровела у него шея. - Он ценит по достоинству и вещи, и людей.
  - Вадь, извини, если чем-то обидел, - Виталий говорил со злорадной офисной вежливостью, больше свойственной женщинам, - но разве ты сам не видишь, что произошло? Или ты думаешь, что этот ваш Гаджиев тут был ни при чем? "Умный дом" и все прочее...
  - Да что вы прицепились к "умному дому"? Тебе будет любопытно узнать, что "умный дом" работал как часы.
  - Как? - Виталий резко поднял голову.
  - Как часы, - спокойно повторил Вадим. - Время, когда открылась калитка, отфиксировано - семь пятьдесят две.
  - А видеокамера? - спросил Сергей.
  Вадим глубоко вздохнул.
  - А видеокамера сбоила. Где-то отошел контакт - моя вина, не следил за этим старьем. Оказалось, изображение с нее давно шло с перерывами, и как раз на это время пришлось "нет сигнала". Хотя толку с нее все равно было бы немного - темнотища, качество изображения никакое. Папа никогда не включает прожектор, говорит, ему от снега светло.
  - Ну да, может быть. Кстати, вы просмотрели все записи за утро?
  - Да, пока ждал полицию. А что?
  - Видели, как Нина Георгиевна уходит кататься на лыжах?
  - Видел, конечно. У тети Нины заскок насчет спорта - вчера засиделись до двух, и не за пустыми стаканами, а утром все равно на лыжню. Я как вечером срубился, так меня они еле разбудили, когда поняли, что отца нет. Ваша, Сергей, мама снегу с окна нагребла и мне в физиономию...
  - Но тете Нине, значит, света хватало?
  - А что ей сделается, вдоль трассы фонари, там вполне светло... Нет, если вы насчет изображения - до восхода солнца люди в видеозаписи получаются в виде темных пятен. Тетю Нину ни с кем не спутаешь - лыжи на плече, потом эта ее острая шапка. Но если у кого-то хватило бы ума напялить, скажем, доху с капюшоном, опознать его по видео было бы проблематично.
  - Да нет, при ограниченном выборе подозреваемых... - начал Сергей, но тут Вадим предложил выпить еще.
  Выпили. Виталий спросил, не могла ли Нина Георгиевна что-то видеть утром. Сергей сказал, что это прекрасная идея, и посоветовал спросить у нее. Виталий замялся, и тут из холла послышался пронзительный голос Марины: "Витя, ты здесь? Иди сюда!"
  - Да, Мариночка, сейчас, - Виталий метнулся к двери, шагнул назад, подхватил свою рюмку, поставил в раковину, приложил палец к губам и поспешил вон.
  Сергей как раз придумывал, о чем бы еще спросить Вадима, когда тот заговорил сам:
  - Вы знаете, чем болен мой отец?
  - Знаю. Болезнь Чена, так, кажется? (Вадим кивнул.) А как вы догадались, что я знаю?
  - Догадался... Ольга Ильинична сказала вашей маме, и вы человек сообразительный. Ну а когда вы заговорили про ограниченный набор подозреваемых... - Вадим невесело ухмыльнулся. Теперь Сергей видел, что они с отцом все-таки похожи: сын крупнее, шире в плечах, но линии лба и носа - те же самые, острые.
  - Да, виноват. Так вы думаете, это они с Мариной?
  - Они? - Вадим широко раскрыл глаза, и в них промелькнуло что-то похожее на радость. Но тут же ответил. - Да нет, вряд ли.
  - Думаете, тетя Ляля не могла сказать Марине?
  - Не могла, - решительно ответил Вадим. - Марина моего отца не выносит, и Ольга Ильинична это знает. И потом... Сергей, вы же поняли ситуацию: тут надо соображать в технике. А эта парочка - пользователи. Мягко говоря.
  - Они могут прикидываться.
  - Так прикидываться невозможно. Витя не мог найти иконки у себя на рабочем столе, после того как менты их нечаянно передвинули на второй экран. Сказал, что у него все стерлось. Мне показалось, что он не знал о существовании второго экрана.
  - Сильно. Но ведь чтобы... ну... чтобы отключить точки доступа, уровень эксперта не обязателен, я правильно понимаю? Можно просто посмотреть в Сети, как делаются такие вещи.
  - В общем, да. Но тем не менее сообразительность нужна. И потом - сигнализация. Вы знаете про сигнализацию?.. Так вот ее отключить уже непросто, надо знать, где.
  - А где?
  - В подвале, щиток с тумблерами там.
  - Туда кто-нибудь вчера спускался?
  - Спускались. Ночью другая сигнализация заорала, пожарная. Здесь она воет как ненормальная, только унюхает угарный газ и дым. Я сам так сделал - дом деревянный, печка, отец бывает один. Надо было вообще печку разобрать, есть отопление. Но он очень хотел, чтобы живой огонь...
  Вадим замолчал, потом откашлялся. Сергей потянулся к бутылке, налил в обе стопки, себе поменьше - у Вадима было явное преимущество по биомассе. Решили выпить на "ты", без лобызаний, но с рукопожатием. Строго сказали водке "и всё, всё", показали ей заслон из ладоней, чтобы она не вздумала предлагать им по четвертой, - этот ритуал Сергей уже освоил. Знал он и то, что зарок может быть впоследствии нарушен, поэтому сразу спросил:
  - Так кто отключал пожарную сигнализацию?
  - Я, - ответил Вадим.
  - С тобой был кто-нибудь?
  - Виталий за мной увязался. И тетя Нина в халате, шла и учила нас, что нам делать. Кажется, больше никто не спускался. Но не уверен, мы выпили вчера здорово.
  - Кто-то из них мог выключить ту, другую сигнализацию?
  Вадим поскреб пальцами бороду.
  - Теоретически да. Это просто рычажок на щитке, без всякой дополнительной защиты. Но там этих рычажков и кнопок... Откуда бы ему знать, который? Он в этом доме первый раз. Да он и не знал про эту сигнализацию, он вообще не должен был знать ни про что... Тетя Нина - тем более нет.
  Почему бы и нет, подумал Сергей. Профессоров в отставке не стоит недооценивать. К тому же, выйдя из дома утром, она могла сговориться с сообщником... Видел ли Вадим в записи, как она вернулась? Точно ли это произошло после того, как ушел ее брат?
  Спрашивать собеседника, не мог ли он сам, как-нибудь эдак случайно, передвинуть не тот рычажок, Сергей не рискнул. Спросил вместо этого:
  - И ты думаешь, это не Гаджиев?
  - Знать наверняка я не могу, но, думаю не он.
  - Мне показалось, он очень привязан к вашей семье, - своим фирменным невинным тоном сказал Сергей.
  - Ты про Альку, что ли? - немедленно отозвался Вадим и налил себе еще. Сергей помотал головой и получил полрюмки. - Ну да, он так на нее смотрит, смех... Я не в плохом смысле! Эдик нормальный парень, потом, Альке всего пятнадцать - раз, и это был бы мезальянс - два.
  - Почему мезальянс? Этот... так сказать, проект с его участием - передний край компьютерной науки, как я понял.
  - Ты это к чему?
  - К тому, что Эдуард уж точно не дурак и не лузер.
  Вадим непонимающе уставился на него, потом захохотал.
  - Да не то! Не для нас мезальянс, для него. У Эдика строгие родители. Очень строгие и очень, э-э... традиционные. Я Альку люблю, но подходящая невеста для мальчика из хорошей религиозной семьи - это не про нее.
  - Мальчика?!
  - А-а... Я один раз слышал, как он разговаривает с мамой. Запретить надо таких мам. Как он ее терпит, не понимаю.
  - А вдруг перестал терпеть? - задумчиво сказал Сергей. - Тот, кого долго держат на поводке, может сорваться. Захотеть, например, много денег сразу и уехать на другую сторону света.
  Вадим помотал головой.
  - Нет, все равно нет. Знаешь, почему? Витя с супругой для этого слишком глупы, а Эдька слишком умен. Черт, да если бы он захотел угробить отца, никто бы концов не нашел, ты прикинь! Там небольшой сбой, сям небольшой сбой, роковые совпадения плюс неизбежные возрастные процессы. Ни один профессор не докажет.
  Сергей сжал голову ладонями. Ему очень не хватало нейтрализатора этанола, но аварийная аптечка была наверху. Может, кофе сварить? Или это не принято, запивать водку кофе?..
  - Ну а если не угробить, а увезти? Если зачем-то надо было сделать именно так? И кстати, что насчет того, кто увез дядю Пашу? У тебя есть идеи?
  - У меня есть целая куча идей, - с пьяной важностью сказал Вадим. - Целая, не побоюсь этого слова, куча. Ты читал отцов мемуар?
  - Нет. Где бы я мог его читать?
  - В Сети. Он пишет и выкладывает по главам. Должен сказать, любопытное чтение. Память на старые дела у него и раньше была хорошая, а после этого компьютерного подключения стала такая, что прямо страшно. У него как кино в голове крутится, он смотрит перед собой и рассказывает, какое было число, когда мы с ним ездили в аквапарк, в каком платье мама была, какие вопросы я ему задавал... И вот он что-то решил всем раздать по серьгам. С кем встречался, что слышал, что писали и говорили... понимаешь, пошел по старикам. Такую решил дать беспристрастную картину эпохи. Разговоры дословно. Кто в какой федеральной программе участвовал, кто жульничал с грантами, кто защитился с сомнительными результатами, кто вообще с чужими... дела давно минувших дней. Неприятные дела.
  - То есть он многих задел.
  - Не то слово.
  - И многие были бы рады, если бы автора воспоминаний публично признали невменяемым?
  Вадим сглотнул.
  - Ты первый сказал, - тихо произнес он. - Я сегодня с утра об этом думаю.
  В этот момент Сергею показалось, что он может обойтись и без кофе, и без алкодетокса. Он даже забыл оказать сопротивление, когда Вадим налил ему еще.
  - Хорошо. Среди героев мемуара были те, кто знает о его болезни?
  - Да всего двое и знают, кроме участников проекта и членов семьи. Левыкин и дядя Слава Акимов. Но про Левыкина он вряд ли писал, Левыкин металлохимик, не его область. Они с отцом в лицее вместе учились, в одном классе, с тех пор дружат.
  - А Акимов?
  - Акимов из его первой лаборатории. Отца из этой лаборатории ушли, но с дядей Славой они потом всю жизнь общались. Не мое дело, но даже мне не нравилось, что он там понаписал. Акимов мог обидеться, он и обижался. Какая-то нездоровая откровенность, "я уже помер и мне плевать на ваши тайны", такой тон. Нет, и страшно за него было, но еще и неприятно, когда из человека все секреты лезут, словно из дырявого мешка...
  Вадим замолчал, видимо, проведя в уме кое-какие параллели и смутившись.
  - Ты это рассказал полицейским?
  - Не рассказал. Я тогда плохо соображал. О чем спросят, о том и говорю. Он спросил, не враждовал ли с кем-то отец, я сказал - нет. Спросил, с кем общался, - тут я дядю Славу назвал. Думаешь, надо было сказать?
  - Возможно. Но ведь они оставили контакты для связи, как раз на случай, если кто-то что-то вспомнит... А кстати, где живет этот Акимов? Он москвич, петербуржец?
  - Москвич. Да фактически он тут живет, в академическом поселке на шестой линии. Еще будешь?
  - Нет-нет, спасибо, теперь точно всё.
  Сергей не чувствовал себя пьяным, только деревянные ступеньки почему-то оказывались не совсем там, где он их видел - то выше, то ниже. Сбились настройки оптической системы, все из-за этих мозговых волн, которыми полон дом. Хотя нет, все же выключено, наверное. Иди, Островски, иди, не греши на хайтек, ты отлично знаешь, что тебе сбило настройки...
  Собираясь на родину предков, алкодетоксом он запасся всерьез, и оставалось еще достаточно. Две капсулы произвели сильнейшее впечатление на отравленный организм. Кровь прилила к лицу, стены и окна плавно поехали по кругу, раз за разом рывками возвращаясь обратно - и от этих рывков особенно тошнило. Но когда часы на экране вифона отсчитали минуту, все прошло, как не было.
  Он умылся холодной водой, расчесал волосы и завязал их в хвост. Предстояла еще одна прогулка.
  
  ***
  
  Солнце уже скрывалось за крышами домов, когда Сергей направился к дому Акимова.
  ...Что же, логично. Никто дядю Пашу не выводит со двора, ему звонит друг, и он сам подходит к калитке. Там его хватают за локоть и выдергивают из поля. Сигнализация уже отключена, об этом позаботился кто-то в доме. И тогда первая подозреваемая - Нина Георгиевна, потому что ее рассказ о следах двух человек - ложь.
  Дом на шестой линии был окружен глухим забором. Сергей влез на сугроб - он скрипел и подавался под ногами, снег лез в башмаки, зато удалось заглянуть во двор.
  Дорожку здесь не чистили, утренний снег лежал нетронутым, никаких следов нигде не видно. В доме должно быть темновато - окна почти полностью закрывали высокие заснеженные кусты, - однако света никто не зажигал, и старомодная кирпичная труба не дымилась. Хотя печь, кажется, топят по утрам?..
  - Молодой человек, вам кого?
  Сергей обернулся. За спиной у него остановился маленький, как кабинка велорикши, двухместный ховеркрафт, баклажанного цвета, с обширным багажником. Рифленая "юбка" раздута воздушным потоком, над крышей тихонько гудит ярко-алое марево - верхний винт мощный, хоть через заборы с таким прыгай. Дверца, украшенная логотипом супермаркета, приоткрыта, из нее выглядывает старичок в вязаной шапке.
  - Мне Акимова, - Сергей спрыгнул с сугроба и обозначил поклон. - Извините, вы не знаете...
  - Так он уехал, - с готовностью сообщил дед. - Ему позвонили соседи из Москвы, он протек на них (по крайней мере, так Сергею послышалось). Сегодня утром уехал, попросил меня, чтоб я отменил его заказ.
  - Вы в супермаркете работаете?
  - На доставке, вот попросили. Там сын моего приятеля топ-менеджер, что же не помочь хорошим людям.
  - А разве у них не автоматы на доставке?
  - Куда могут проехать автоматы, - наставительно сказал старик, - туда доставляют автоматы. А куда не могут, туда я. У них бортовой компьютер слабенький, где им понять, что третью линию не чистят, а на пятой линии канава с лета не закопана. У них и алгоритма такого нет - "канава". Ничего, платят нормально. Мне-то пенсии хватает, а вот Лешке, внуку, подкинуть на карманные расходы - мать говорит, я его балую, ну и пусть говорит. Когда человеку четырнадцать, он себе за деньги купит радость, а потом уже не будет радости, будет средство выживания, вот и все...
  ...Пожилой курьер, скучающий в безлюдном по зимнему времени поселке. Заезжает на участки, куда не проехать автоматам, мимо остальных ездит каждый день...
  - А Вячеслав Никитич не сказал, когда вернется?
  - Не сказал, да кто ж это знает, если соседей залило, мало ли... Простите, а вы ему кто?
  - А я племянник Зарубиных, сын сестры Ольги Ильиничны. Сергей.
  - Николай Петрович, - водитель стащил зимнюю перчатку, пожал протянутую руку. - Что там у вас, случилось что-то? - полицию я видел утром...
  - Залезть к нам пытались, - ответил Сергей.
  - Что вы говорите?!
  - Угу. Главное, у дяди вчера был день рождения, посидели, потом спали, конечно, крепко. А меня вчера не было, я сегодня приехал...
  Сергей импровизировал в меру загадочную, в меру безобидную историю попытки проникновения в частное владение, Николай Петрович слушал с живым сочувствием. Слово за слово, выяснилось, что он едет обратно в супермаркет, а Сергею тоже туда надо, и он уселся рядом с водителем. В салоне было тепло, под зеркальцем заднего вида, согласно традициям, висели маленькая икона, ароматизатор и пляшущая фигурка из деревянных шариков на веревочках.
  - А вы с Павлом Георгиевичем знакомы?
  - С вот такого возраста, - дед усмехнулся и показал ладонью где-то под приборной доской. - Ну как знакомы, не близко, я его постарше лет на десять. И потом он стал большим ученым, лауреатом, а мы-то просто технари, и я, и отец был технарь. Но живем ведь на глазах друг у друга, поселок маленький - можно считать, что знакомы.
  - Дядя и зимой тут живет, правда?
  - И зимой. Я им продукты вожу. Сын, Вадька, у него хороший, вежливый, всегда первый здоровается, дядей Колей меня зовет. Когда он заказывает, всегда ставит точку на "доставку с курьером" - я ж понимаю, по доброте, курьер здесь только я, хочет дать заработать. Вы Вадьку знаете?
  - Да, он сейчас тут.
  - Хороший парень. К отцу часто приезжает. Я так считаю, старики не должны молодым навязываться. Надо быть самодостаточным человеком, тогда дети сами к тебе потянутся. Вот, например, Лешка, внук мой...
  Сергей слушал Николая Петровича, кивал и соглашался, а когда это стало приличным, задал следующий вопрос:
  - Но я так понял, дядюшка тут не скучает, он работает. У него все время сидит этот Эдуард... забыл, как там дальше.
  - Да как-то не по-русски там дальше, - охотно подсказал дед. - Но я считаю, не в этом дело, кто русский, кто нет. Я вообще к дагам или там к татарам хорошо отношусь, они давно в России живут, а что раньше было, то прошло. Главное, чтобы человек был хороший. Вот негры, которые южнее Сахары, - это поганый народ, с дерьмецом, прошу прощения. Ходят, работы ищут, а какой им работы? Я говорю, твой дед без штанов за антилопами бегал, папаша жил на пособие, и теперь тебе работу, чтобы ничего не делать, а только деньги получать?.. Ага!
  - Эдуард, мне показалось, нормальный парень, - осторожно вставил слово Сергей.
  - Я и говорю, что нормальный. Тоже ездит из Москвы к ним каждую неделю. Он из института, где Павел работал?
  - По-моему, да, - сказал Сергей. - А он к Вячеславу Никитичу заходит?
  Дед задумался.
  - Не знаю, врать не буду. А они разве из одного института?
  - Наверное, нет, это я перепутал.
  - Вот Акимов к вашему дядюшке в гости ходит, - продолжал дед. - А тот к нему не ходит. Может, жена не пускает, хе-хе, боится, что выпьют лишнего, Слава холостой, за ним пригляда нет... Да, еще он на лыжах по утрам катается, и Павлову сестру с собой приглашает, Нину. Я их вижу по утрам - идут такие деловые, лыжи на плечах несут... А вон там живет Наташа, наш доктор, она тоже к Павлу ездит. Дай ей Бог здоровья, приглядывает за нами, выручает иной раз, особенно сейчас, зимой. Тут, знаете, пока из Вязем доктор доедет, тридцать раз помрешь. А у нее такая же машинка, как у меня, "яуза" четвертая. Сама водит, сама чинит. И что она здесь забыла, не понимаю. Ладно мы, старые пни, а когда молодая толковая женщина приехала из Москвы и круглый год тут сидит... Не знаете, в чем тут дело?
  Сергей покосился на Николая Петровича. Ох уж эти пожилые соседи с избытком времени для аналитических размышлений. Эдак он может и догадаться, что доктор Наташа во время визитов к Павлу Георгиевичу собирает материал для научной работы, какого не найдешь ни в одной столице...
  - Не знаю, - сказал он. - Я ее видел всего раз, мельком. Думаете, может быть любовь?
  - Любовь? К кому?!.. У нас тут молодежи нет. Ну, наши манагеры, но они, при всем уважении, не пара ей. Их не учат ничему, производить впечатление их учат...
  Этой интересной темы хватило до самого супермаркета. Вывести разговор на совместные прогулки Акимова и Нины Георгиевны, к сожалению, не удалось.
  
  ***
  
  Сергей закрыл текстовое окно и крепко потер глаза пальцами. Проклятый мемуар не только не отсек лишние версии, но обогатил схему парой-тройкой ответвлений, и таких, которые Сергею как частному лицу активно не нравились.
  Фигура умолчания на месте первой жены - дядюшка именовал ее "мама моего сына" - побуждала задать вопрос: точно ли Вадим любил отца? Когда его мать и дядя Паша расстались, ему было, наверное, столько же, сколько Ариадне сейчас...
  О муже сестры Павел Георгиевич выразился так - "человек, который сам ничего не достиг и Нине не позволил". Оказывается, она была замужем. Трудно сказать, могла ли Нина Георгиевна обидеться за бывшего или покойного супруга, но свои достижения она вряд ли считает нулевыми.
  Поэтичные абзацы, посвященные женщинам (в том числе и Машеньке Звягинцевой), заставляли иначе взглянуть на горе тетя Ляли. В конце концов, что он знал об их отношениях? Зато прекрасно знал из собственного профессионального опыта, какую боль могут причинить женщине откровения стареющего мужа и какие из этого бывают следствия.
  Прав был Вадим. Дурацкая манера - сводить счеты с жизнью и людьми, выволакивать на свет обидную правду, которую время милосердно припрятало с глаз долой. Почему бы не быть добрее, не ограничиться положительными характеристиками... А правду-матку резать про одного-единственного врага, верно, детектив Островски?
  
  
  В глазах щипало, мысли убредали в сторону, и Сергей спустился в кухню за кофе. Уже совсем стемнело, свет из окон падал на белые ветви кустов, а дальше была чернота.
  На кухне он встретил маму. Доктор Островски стояла у лестницы в подвал, заглядывала вниз и хмурилась.
  - Что случилось?
  - Понимаешь, я сижу, а Альки все нет и нет. Ну мало ли что... но потом я забеспокоилась, нашла у Ляли ее ай-файнд, с данными от маячка...
  Мама замолчала и значительно указала пальцем вниз.
  - В подвале, что ли? - Сергей ухмыльнулся. - С Эдуардом? И ты подумала, что ей всего пятнадцать и все такое...
  - Что ты несешь?! - мама оглянулась и продолжила тише: - Пятнадцать, не пятнадцать, ей нечего делать в этом подвале! Она умная девочка, что-то Эд ей разболтает, о чем-то догадается, что тогда будет?! Включи голову!
  - Мам, не ругайся. Алька сейчас наверху, у меня.
  - Как у тебя? Что она там делает?
  - То есть не у меня, а в чулане. Пришла спросить, сколько надо выпить коньяку, чтобы перестать волноваться и заснуть, представляешь?! Я отвел ее в чулан, показал коробку с игрушками начала века. Знаешь, кнопочные, с маленькими экранчиками. Ей удалось включить некоторые, теперь она сидит там на полу, давит на кнопки и, кажется, даже смеется.
  - Да? А как же тогда...
  - Разберемся, - он мягко отстранил маму и сбежал по лестнице.
  Подвал было не заперт, свет горел только нижний. Сергей бесшумно отжал ручку, открыл дверь и щелкнул выключателем. За стеллажами что-то сдавленно охнуло, брякнуло об пол.
  Сергей обошел стеллажи и увидел Эдуарда. Тот смотрел настороженно, и в руке у него был, видимо, только что подобранный с пола вифон. Неплохой, мощный, но в жемчужно-розовом корпусе, и по нему черная корявая надпись маркером: IT"S NOT PINK!!!
  - Цел? - тут же спросил Сергей.
  - Цел.
  - Зачем вы взяли его у Ариадны?
  - Так мой заблокирован.
  - Вы в курсе, что на него установлен маячок?
  Эдуард моргнул, потом вытаращил глаза.
  - А... То есть Ольга Ильинична подумала...
  - Пока только Анна Ильинична, - Сергей сделал успокаивающий жест, - и я ей уже сказал, что Аля сидит на чердаке. Итак, зачем?.. Нет, компьютеров в доме полно, а блок только на вашем вифоне. Но вам понадобился тот, запросы с которого наверняка не будут проверять.
  Эдуард молчал, опустив глаза. Ресницы у него были как у девушки, коротко остриженные волосы ложились на лоб смешными завитками. Сергей знал, как в России относятся к выходцам с Кавказа. Примерно как в Америке к латиноамериканцам, только хуже (тут накладывались какие-то прискорбные исторические события начала века). По меткому замечанию старого курьера - они лучше, чем африканцы. О да, избиратели и налогоплательщики, люди как люди, если только не нелегалы, не члены преступной группировки, не фанатики и не асоциальные от природы типы. Конечно, не все они такие, никто и не говорит, что все, но репутация... А репутация, детектив Островски, создается прецедентами, так что не будем расслабляться.
  - Я не считаю, что вы организатор похищения, - заговорил он снова. - Точнее, скажем, так: не вы тут самый подозрительный. А если это сделали не вы, то в ваших интересах мне помочь. Скажите мне, что вы ищете.
  - Если скажу, что ищу, вы перемените свое мнение. - Говорил он почти без акцента, только твердые согласные иногда выговаривались мягкими и наоборот. Сергей только махнул рукой, мол, хватит тянуть.
  - У меня есть счет... то есть он на моего двоюродного брата, его имя и код, но пользуюсь им я. Так, ну, часть денег мне туда приходит, за всякие работы. На личные расходы.
  - Понял, - Сергей вспомнил, что говорил Вадим про его маму. - И что с этим счетом?
  - Платеж поступил сегодня. Я не знаю, от кого, за что. Понимаете?
  - Много?
  - Тридцать тысяч.
  - Хм. Для случайности многовато, для платы за похищение маловато. - А вот для подставы в самый раз... - От кого?
  - Анонимный перевод.
  - Дайте сюда. (Эдуард молча накрыл экран ладонью.) Эд, я говорю серьезно. Вы ничего не найдете, вы спец в вашей области, но в этих делах. Тут спец, так уж получилось, я. Хотите договор: вы мне показываете этот ваш счет и сведения о переводе, а я вам рассказываю, что узнаю? Лучше я сегодня, чем полиция завтра. ...Ну вот и ладно.
  Его на секунду смутило отсутствие привычного интерфейса - сестренка, как это было принято среди некоторых умников, не пользовалась общедоступными коммерческими продуктами. Но и он не зря прокачивал навыки.
  - Сейчас посмотрим, что тут к чему... А, я же хотел кофе!
  - Я вам налью, - коротко сказал Эдуард и вынул чашку из подстольного ящика.
  Сергей опасался, как бы не нахвастаться впустую: все же русские платежные системы имеют свою специфику. Но неведомый благотворитель шифровался не особенно старательно. За хвост удалось ухватиться с первой попытки, и не успел он допить кофе, как ответ появился на экране.
  - Акимов Вячеслав Никитич. Платеж с карты.
  Они посмотрели друг на друга. Судя по выражению лица, конструктивных идей у Гаджиева не появилось.
  - Он ведь друг Павла Георгиевича?
  - Да.
  - Он точно не был вам должен денег или?.. (Эдуард, не дослушав, помотал головой.) А кто здесь знал про этот ваш счет?
  - Никто не знал. Вообще никто не знал, кроме брата.
  Сергей отхлебнул из кружки и поморщился.
  - Ну, кто-то выходит, знал... Скажите, Эд, зачем вы покупаете эту дрянь? - он ткнул пальцем в пакетик с красными буквами "МОКА".
  - Нормальный кофе. Кофеин, натуральный сахар. Мне же не для удовольствия, мне чтобы не спать.
  - Натуральный сахар... У вас мало денег?
  - У меня семья. Родители, дедушка с бабушкой, сестры. Отец болеет, ему деньги нужны на лекарства. Я не понял, а зачем вы спрашиваете?
  - Да нет, это я так. Извините, пожалуйста.
  
  ***
  
  ...Итак, их было как минимум двое. Кто-то отключил сигнализацию, и кто-то увез Павла Георгиевича. Первого все еще не удается вычислить. Второй? В поселке двое были посвящены в тайну: Акимов и доктор Наташа. Если это Акимов, он никуда не денется. Хотя на российских дорогах камеры слежения работают через одну, все же они работают. И если известно время, когда дядя вышел из калитки, то понятно, с какого момента сотрудники полиции должны просматривать записи с камер на шоссе. Машину друга похищенного, который тем же утром зачем-то направился в Москву, они не пропустят. Скорее всего, с ним уже беседуют. Или же он хитрее, чем мне кажется. Хитрее и сволочнее, но тогда уже ничем не поможешь...
  Что касается докторши, не хватает малости: мотива. К ней, насколько я понял, все хорошо относились, она была расстроена исчезновением Павла Георгиевича, когда я ее увидел утром. Есть, конечно, третий вариант: незнакомый сообщник...
  Ладно, остается еще стереоролик со вчерашнего вечера. Продолжительность ролика - три часа, а если умножить на все стороны света... Нереально, время поджимает. Надо что-то придумать, какой-нибудь фильтр.
  И тут его осенило. Тот случай, когда отрицательный результат - вовсе не результат, зато положительный мог бы решить все его проблемы.
  Он открыл поиск по образам, поместил в окошко зеленую свечу в подсвечнике (и на том спасибо, что все свечи на столе были одинаковыми). Добавил "перекрывание телесным цветом", ввел поправки и исключения, запустил поиск.
  Ну а если это все-таки Эдуард? Тогда не найду ничего. Ему это ни к чему.
  Окно поиска до половины завесила шторка из строчек - кадров было много.
  Тетя Ляля и мама зажигают свечи, это первые восемь. Наверняка пустышки, но просмотреть надо. Нет... нет... ничего...
  Нина Георгиевна отодвигает подсвечник, чтобы освободить место для тарелки. Нет.
  Марина указывает пальчиком на каплю парафина, ползущую по цоколю подсвечника, муж послушно берет салфетку, ага, это уже следующий результат... Все чисто.
  Дядя с тетей. Тетя придвигает свечу поближе, потом поднимает мандариновую корку, сжимает ее пальцами, из пламени свечи вылетают острия пылающего эфирного масла. Дядя улыбается, обнимает жену за плечи. Все, больше ничего. Сергей отчаянно зевнул. Дурацкая затея, он или она могли воспользоваться десятком других способов... Нет уж, досмотрю.
  Вадим зубочисткой снимает нагар со свечи.
  Нина Георгиевна переставляет свечу на каминную полку... Стоп, ну-ка назад!
  Сергей просмотрел эпизод еще раз. Вернулся к началу, включил зум и замедление, просмотрел медленно. Откинулся в кресле. В черном окне отражались лампа и экран, потом экран погас. На чердаке становилось холодно, но он не включал обогревателя.
  Кристаллизация из пересыщенного раствора. Кто-то уронил в стакан крупинку соли, песчинку или щепочку, и еще быстрее, чем она погружается в тяжелую прозрачную жидкость, на ее пути растут стрельчатые леса, торопливо, как струйки воды, тончайшие иголочки складываются в готический шпиль. Это уже не "версия", это ответ. И такой ответ, что черное окно стало страшным, как в детстве, будто там, снаружи, бродит огромное чудовище и вот-вот приблизит к стеклу свою морду, и когда свет упадет на нее, тут-то мне и конец...
  Он несколько раз перевел дух, чтобы успокоиться, закрыл видеоролик и запустил обычный поисковик.
  Когда Сергей выяснил все или почти все, часы на экране показывали без пятнадцати семь. Ложиться спать не стоило, да и время поджимало. Он открыл почту, старательно подбирая слова, составил официальное письмо. Потом сложил в заспинный карман все, что могло понадобиться, и спустился на первый этаж.
  
  
  Сергей не стал включать кофеварку - сделал кофе в чашке, получилось почти так же отвратительно, как у Эдуарда. Зато захотелось есть. Откусывая от бутерброда и прихлебывая бурую полупрозрачную жидкость, он прислушивался к шагам в комнате, выжидая, когда будет прилично постучаться. Но Нина Георгиевна вышла сама, уже в спортивном костюме.
  - Ох, Сережа, это вы, в такую рань на ногах? Что-то узнали о Паше?
  - Нина Георгиевна, я вас дожидался. Хочу спросить вас кое о чем.
  - Что такое?.. Нет-нет, кофе не надо, я завтракаю позже, пока только коктейль, - она прошла к холодильнику и взяла оттуда маленькую бутылочку с логотипом олимпиады.
  - Я снова насчет этих следов - ну, вы говорили вчера, что увидели следы во дворе. Простите, мне в это не верится.
  - Отчего же?
  - Фонарь во дворе никто не зажигал. Свет в кухне и гостиной вы, наверное, погасили, когда уходили. Вот вы входите во двор, после улицы здесь кажется совсем темно...
  - Не было темно. Было светло от снега, был свет из окон.
  - Из каких окон?
  - Из наших. Свет падал слева от дорожки, двор был хорошо виден... Сереженька, почему вы так волнуетесь? Я старая женщина, стала бы я выдумывать? Если я говорю, что были следы...
  - Я все понял, Нина Георгиевна, просто хотелось уточнить. Еще только один вопрос: вы вчера катались одна или вместе с Акимовым?
  Нина Георгиевна возмущенно откинула голову.
  - С ним, да. Но какое это имеет... Или вы думаете, что он замешан?.. Да нет же, нет, мы все время были вместе. Расстались на углу, но Паши, получается, тогда уже не было дома...
  Она разволновалась и смутилась, но не так, как уличенный преступник. Сергей поглядел на нее искоса. На сухощавую фигуру, затянутую в новый термокостюм - за фигурой она следила, как другие пожилые особы следят за клумбами георгинов или порядком в квартире, и в утренней полутьме, сглаживающей линии плеч и локтей, ей можно было дать лет сорок пять. На старомодную шапочку с помпоном, на пушистую варежку с норвежскими звездами. Розовая помада на губах - допустим, против обветривания, но накрашенные ресницы зимним утром, перед лыжной прогулкой?..
  - Вы и сегодня с ним встречаетесь?
  - Нет, сегодня мы не договаривались, - чопорно ответила Нина Георгиевна.
  - Я почему спросил: мне дядя Коля, курьер, сказал, что он вчера уехал в Москву. Какие-то проблемы с соседями, кажется, он их залил.
  Эта пустяковая подробность удивительно обрадовала старую даму. Как девчонку, которая, полдня проревев, узнала, что кавалер не перезвонил, потому что не мог.
  - А, я поняла. У него старый дом, там вечно... Надо будет ему позвонить.
  - Обязательно позвоните.
  - Сережа, вы не осуждаете меня, что я еду кататься, когда такое горе? Может быть, мне остаться?
  - Нет-нет, что вы, - с полной искренностью сказал Сергей.
  В самом деле, так будет лучше. Он надеялся все закончить до того, как она вернется.
  
  ***
  
  Когда за Ниной Георгиевной закрылась дверь, Сергей отправил сообщение маме. Он знал, что она просыпается рано, и действительно, она тут же ответила. Тогда он поднялся на второй этаж и постучал в дверь.
  Вадим отозвался не сразу.
  - Кто?
  - Вадим, это Сергей. Откройте, пожалуйста.
  - Что? Что такое?
  - Насчет Павла Георгиевича. Срочно.
  Вадим был взлохмачен и бос, успел только натянуть брюки и футболку.
  - Я вчера узнал занятную вещь. На секретный счет Эдуарда поступил платеж, как нетрудно было выяснить даже мне, а тем более полиции, - от Вячеслава Никитича. Акимов сегодня утром уехал, по его собственному заявлению, в Москву. Примем за нулевой вариант, что Эдуард отключил ретранслятор излучения и сигнализацию, вывел дядю Пашу со двора и сдал с рук на руки Акимову, который и увез его. Но тут есть ряд неувязок. Давайте я вам расскажу
  - Одну минуту, - Вадим подошел к окну и распахнул створку, впустив в комнату сырой зимний воздух. Зачерпнул горстью снег с подоконника, обтер лицо и стряхнул капли. - Мы на "ты", не забыл?
  - Хорошо. Во-первых, мы с тобой вместе решили, что Эдуард не стал бы действовать так тупо. Во-вторых, тридцать тысяч - смешная сумма за такое большое предательство. Если это не он, значит, Эдуарда кто-то подставляет. Возможно, сам Акимов. Неумный ход, но кто сказал, что он специалист в этих делах? Однако есть и альтернативный вариант - кто-то третий подставляет и самого Акимова. Тогда возникает вопрос: кто бы это мог быть.
  - Ну и кто? - Вадим уселся на смятую кровать.
  - Этот злоумышленник должен был иметь возможность спуститься в подвал у всех на глазах, чтобы выключить сигнализацию. Там был ты, Эдуард, Виталий, Нина Георгиевна. Затем, утром надо было отключить ретранслятор и, возможно, видеокамеру. Я нашел на одной из антенн каплю коньяка. Как она туда попала, интересно? Серебряные рюмки, как раз подходящего размера, надеть их на антенны можно за полминуты, а потом, когда все будет кончено, так же снять. И, разумеется, на всех рюмках есть свежие отпечатки твоих пальцев и следы ДНК, ты же их все перетрогал, когда предлагал нам выпить.
  Вадим открыл рот. Казалось, он не может поверить, что в самом деле это услышал.
  - Это ты намекаешь... Это я, значит, у тебя похититель?! Мило. Но почему все-таки не Виталий и не тетя Нина? Из-за рюмок?
  - Про Югановых мы вместе поговорили. Технически малограмотные, не доказано, что знали о болезни Павла Георгиевича, редко бывали в этом доме. Их я готов был рассмотреть, если провалятся все остальные версии. О Нине Георгиевне я думал очень серьезно. Она каждое утро встает рано, бывает одна на первом этаже, это не привлекает ничьего внимания. Она общается с Акимовым, которого, как и ее саму, дядя Паша обидел в своих записках. Наконец, она наследница. Но вот еще два момента. Во-первых, весьма маловероятно, чтобы она или Акимов знали номер секретного счета Эдуарда. А во-вторых, и это главное - ей не просто невыгодно, а крайне нежелательно, чтобы ее брат исчез. Я узнавал, при любом раскладе дача достанется не ей, а жене или сыну. Она получит солидную сумму в банке, но не дачу. К тебе в гости ей будет неудобно приезжать почаще и оставаться подольше, а ее интересует именно это...
  - Что ты несешь? Причем тут дача, зачем она ей сдалась?!
  ...Затем, что одиночество пугает даже самых разумных и храбрых женщин. Затем, что романтических затей старики стесняются больше, чем подростки, а шифруются куда хитрее. (Да и кому из нас есть дело до того, как проводит свободное время пожилая тетушка?) Затем, что в Москве невозможно отыскать приличный повод для встречи с другом брата. Затем, что этот друг то ли несообразителен, то ли опасается женщин с серьезными намерениями, то ли сам не знает, чего ему надо, и утренние катания на лыжах - пока максимум, которого удалось достичь...
  - Думаю, нас это не касается, - сказал он вслух. - Вернемся к первому пункту. Ты, напротив, был в курсе семейных проблем Гаджиева, мог знать и то, куда он складывает деньги втайне от своей матушки. Вполне возможно, что ты знал пароль от счета Акимова - он мог попросить сына друга о какой-нибудь услуге или подсказке, это старики не знают паролей молодых, а наоборот - сплошь и рядом. Его чип-карта могла заваляться у тебя в кармане - меня убивает эта местная манера выбрасывать чипы, как мусор, если на них не осталось денег. Организовать звонок от соседей по московской квартире и совсем несложно. Теперь Вячеславу Никитичу предстоят незабываемые часы в обществе майора Хохлова из следственного управления. Пока он докажет, что не высадил друга юности где-нибудь в лесочке у Ленинградского шоссе, может пройти много времени.
  Сергей встал со стула и прошелся взад-вперед. Вадим молча наблюдал за ним. По его лицу ничего нельзя было прочесть.
  - Кстати, я пока не знаю, что на самом деле собирались делать с похищенным. Мне лично не верится, что его высадили в лесочке и уехали. Скажи, что нет.
  - Да ты... Ты... - Вадим сжал кулаки. Ага, разозлился и подогревает в себе злость.
  - Рад слышать. И вряд ли его увезли на вертолете, не прошло бы это незамеченным в таком тихом месте. Вряд ли также увели пешком - погода не та, здоровье не то, свидетели могли попасться, хоть и темно. Возможно, он и сейчас в поселке. А Акимов в Москве. Может быть, конечно, он нанял сиделку и уехал. Но есть и другой человек, вхожий в этот дом: доктор Наталья Владимировна.
  - А с ней что не так?
  - Я заметил две вещи. Во-первых, ты человек, абсолютно не склонный к паспортным формальностям. Ну, вторую жену отца по имени-отчеству, это понятно, но моя мама для тебя тетя Аня, курьер из супермаркета - дядя Коля, Эдуард - Эдька, я через полчаса знакомства - Сергей. Она же пять лет наблюдает твоего отца, постоянно бывает в доме, и вдруг почему-то Наталья Владимировна. Мелочь, а цепляет. Люди так разговаривают, когда хотят скрыть отношения. А во-вторых, когда я ее увидел утром - она мало спала и не переплетала волосы с вечера. Когда косу заплетают утром, она иначе выглядит.
  - Господи, - Вадим криво усмехнулся, покачивая головой, - ты сам-то понимаешь, что говоришь? Это же несерьезно.
  - Сейчас будет серьезно. Вы спустились в подвал, чтобы выключить пожарную сигнализацию, которая орала на весь поселок. Но почему она сработала?
  - Откуда я знаю, почему? Она каждую неделю срабатывает.
  - Я тебе скажу, почему. Один из тех, кто сидел за столом, взял зубочистку или гвоздь, проткнул в свече отверстие до фитиля и затолкал туда что-то - комочек волос, нитку, саму зубочистку - не знаю, теперь уже не установишь. Запах пошел примерно через полчаса, когда свеча догорела до нужного места. Хорошо, что есть видеоролик...
  - Да ты совсем уже? Что ты мог увидеть?! Где была камера и где мои руки? Я снимал капли со свечи, понятно? Криминалист, блин.
  - Значит, если я сейчас заеду к Наталье Владимировне, я никого не встречу у нее в гостях?
  Вадим поднялся с кровати, шагнул вперед, шаря у себя в кармане. Сергей едва удержался, чтобы не вскочить в боевую стойку. Какого хрена я не провез нейроствол, комната тесная, мне только грохота не хватало...
  - О, а вот этого не надо, - он замедлил движение руки и почесал подбородок, - ты ж понимаешь, я не просто так пришел. Майор Хохлов и мне сбросил свою визитку. Письмо у меня в почте, мой ящик тебе не взломать, отправка отсрочена... м-м... четверть часа у нас есть на размышления, но не больше.
  - Ты ненормальный.
  - Нет вопроса, - спокойно сказал Сергей, - докажи мне, что я ошибаюсь, и я сотру письмо.
  Вадим первым отвел глаза и снова сел.
  - Да, и еще три мелкие детали, просто для порядка, - Сергей знал, что теперь он будет слушать и что надо дать ему немного времени. - Ты зачем-то соврал, что лег вечером и спал, пока моя мама тебя не разбудила, - знаю, что соврал, потому что Нина Георгиевна, когда возвращалась с прогулки, видела свет в твоем окне. А у доктора Наташи машина той же марки, что у курьера из службы доставки местного супермаркета. Если кто заметил ее утром, - решил, что везут йогурты или пиццу, и никто не сможет поклясться, что это был не курьер. Очень удобно. И третье: я едва не рехнулся, пока пытался понять, как соучастник узнал, что все сделано и можно подъезжать. Все исходящие под контролем, не платочком же вы махали в окно. А ответ элементарный: вам не нужно было трудиться. Она, как лечащий врач Павла Георгиевича, получала сигналы с вашего главного компьютера, наверняка все дублировалось к ней. Следователю она могла сказать, что спала и не заметила отключения сигнализации, и не было причин ей не поверить. Но ведь Наталья, как мы договорились, не спала той ночью. С ее мотивом у меня по-прежнему провал. Она врач, она участник уникального эксперимента, и вдруг... Хотя догадка есть. И при этом мотиве в сообщники подходишь опять же только ты - не Виталий, потому что она не похожа на любительницу женатых мужчин, не мальчишка Эдуард и тем более не дамы.
  Последнюю фразу Сергей договорил устало. Кураж улетучился, решение сошлось с ответом - достаточно было взглянуть на лицо Вадима, на то, как он сидит. Пора было двигаться дальше, и что будет, если я скажу неправильные слова?
  - Вадим, давай заканчивать это дело.
  - Какое дело?
  - Хватит разыгрывать роман Достоевского. Ты не Раскольников, я не Порфирий, вообще никогда эту книгу не любил, как и "Карамазовых"... Ладно, извини. Ты затеял такое, что тебе не выдержать. Ты все просчитал, кроме одного: это затея для социопата. А нормальный человек не может такое сотворить со своим отцом. То есть технически ты мог бы, как тот же Раскольников. Следуя принятому решению, проявляя силу воли и все такое. А через месяц сам попал бы в психушку.
  Вадим то ли фыркнул, то ли всхлипнул. Потом тихо спросил:
  - Чего ты хочешь?
  - Хочу, чтобы мы вернули Павла Георгиевича сюда. Прямо сейчас.
  - А я чтобы отправился в тюрьму?
  - Нет, зачем? Я плохо разбираюсь в здешних законах, но если я не разучился читать по-русски, добровольное возвращение похищенного освобождает от ответственности. Дело будет закрыто, и никто не пострадает. Конечно, если нет вреда здоровью похищенного. И это возвращает нас к фактору времени, Вадим.
  - Думаешь, перезагрузка пройдет успешно? - Вадим оскалился - улыбкой, даже кривой, эту гримасу назвать было невозможно, белые зубы страшновато поблескивали в бороде. - А если...
  Его оборвал тихий стук в дверь.
  - Мама?
  - Мальчики, вы тут? - Анна Островски заглянула в комнату. - Сережа, что случилось?
  - Все в порядке, мам, - Сергей старался говорить спокойно. - Сейчас едем за дядей Пашей. На твоей машине.
  Он сделал приглашающий жест, и Вадим покорно встал. Сергей пропустил его вперед и подмигнул маме.
  Ради этого стоило не спать ночь. Она хмурилась, но морщинка между бровей появлялась и исчезала, а губы улыбались. Как когда он в двенадцать лет взял кубок штата по сетевому поиску. Молодец, Островски. Еще два-три найденных родственника, и тебе простят отказ от Гарварда.
  
  ***
  
  На улице чернота сменилась темной синевой, и опять пошел снег - в белом пятне света под фонарем мелькала крупка, совсем не похожая на вчерашний лебяжий пух. Снег, несомый ветром, сверкал перед фарами машины, как бенгальский огонь, жалил в лицо, стучал по жесткой ткани куртки. Мама села за руль, Вадим и Сергей залезли на заднее сиденье.
  - Я позвоню ей? - не глядя на него, спросил Вадим.
  - Не стоит, - кротко сказал Сергей, - лучше мы подождем у входа. Хотя ты же знаешь код от калитки, так?
  Вадим промолчал.
  - Мам, налево и потом второй поворот опять налево, там я покажу... Вадим, пока мы едем, могу я задать тебе вопрос?
  - Почему нет? Задавай.
  - Зачем ты это сделал?
  - Не догадался, умный?
  - Ты захотел отомстить за твою маму?
  - Господи, - Вадим скривился, - да что ж вас всех так тянет на эффекты... Нет, в принципе ты прав, может, и стоило. У мамы был инсульт, она так и не встала. Никто ей не построил когнитивного протеза, что ты. Обычный человек, обычная болезнь, Бог дал, Бог взял, мужайтесь. Он переводил деньги, но не пришел к ней ни разу.
  - А сама она хотела, чтобы он ее увидел? - подала голос мама с водительского места. - Чтоб бывший муж зашел и посмотрел на нее в таком положении?
  - Ну, вы все знаете лучше меня, - тут же ощетинился Вадим.
  - Сколько тебе было лет?
  - Ты же прочитал, раз спросил про это. Девятнадцать - когда первый инсульт, двадцать один - когда ее не стало.
  - Сочувствую. - Сергей покосился на свою маму, и дурацкое слово прозвучало лучше, чем могло бы. - Но если не месть, тогда что?
  - Деньги... - он опять усмехнулся а-ля Рогожин и шутовски развел руками.
  Прежде чем Сергей успел открыть рот, в допрос опять вмешалось стороннее лицо:
  - Вадька, ты охренел?! Какие еще деньги? Что, тебе не хватало? Или ты так шутишь? Нет, ты совсем...
  - Мама, пожалуйста, смотри вперед, будет глупо, если мы засядем в сугробе! - рявкнул Сергей и, против ожидания, получил возможность продолжать.
  - Вадим, я сам удивлен. И мне тоже казалось, что тебе хватает на жизнь.
  - На жизнь хватало. А на здоровье - нет.
  - Объясни.
  - У меня болезнь Чена, - безразличным тоном сказал Вадим.
  Машина резко тормознула, их мотнуло вперед. Доктор Анна Островски вывернулась на сиденье, насколько позволяли ремни, уцепилась рукой за подголовник:
  - Да? У тебя болезнь Чена, что ты говоришь!
  - Хорошо, сейчас еще нет. Мне дали два года, - так же монотонно сказал Вадим.
  - Кто тебе дал два года, что за добрые люди?
  - Я обращался в частную клинику, где рассчитывают предрасположенность к заболеваниям... Девяносто шесть процентов, что в течение двух лет, оставшийся процент на то, что протяну пять.
  - Девяносто шесть процентов. Кошмар! - мама взмахнула кистями рук и растопырила пальцы, как дикобраз иголки, - компактный вариант жеста отчаяния. - А что методик расчета предрасположенности для болезни Чена не существует, они тебе забыли сказать?
  - Конечно, если у вас в Америке чего-то нет, этого нет.
  - Причем тут Америка! Да вообще не факт, что это заболевание наследственное, у Пашки с двадцати лет допуски по вредности! Какой, нафиг, расчет предрасположенности?! По каким факторам?
  - Если вы чего-то не знаете, этого нет, - с той же тупой язвительностью повторил Вадим. Мама молча схватилась за лоб.
  - Дай угадаю, - сказал Сергей. - Та же клиника предложила тебе пройти курс лечения?
  - Не та же, но по их рекомендации! - с вызовом ответил Вадим.
  - Курс дорогостоящий.
  - Миллион на одного.
  - Рублей?.. Мамочка, время! Давай поедем, а разбираться будем потом.
  - Сам же начал, - буркнула мама, но нажала кнопку.
  - И ты решил получить наследство. Скажи уж, что хотел сделать с Павлом Георгиевичем, - мамочка, держи руль и смотри вперед, третий участок отсюда... Не под протокол. Честное слово, ничего не пишу сейчас.
  - Я бы оставил его в метро, - сдавленным голосом сказал Вадим. - Если бы полиция вышла на меня, сказал бы, что нечаянно потерял его и боялся признаться.
  Мама промолчала, но Сергей увидел ее лицо в зеркальце.
  - Ну да, без документов... - торопливо сказал он. - Пока введут портрет в базу, прочитают ДНК, пока получат все разрешения, сделают запросы - двадцать четыре часа?
  - Я тебя умоляю, - сказала мама. - Пока его доставят куда надо - сутки, пока все пройдет по инстанциям - еще двое суток, а хватило бы и меньше...
  Спрашивать, почему на простое дело уйдет двое суток, Сергей не стал. Впрочем, в другой ситуации ничего страшного в этом не было бы.
  - Мамочка, стоп, мы приехали. ...А просто поговорить с отцом, рассказать ему все - такой вариант не рассматривал?
  - Я начинал с ним говорить. Предлагал ему самому, хотя у него уже вторая стадия, там они не дают гарантии... Он, как вы, сказал, что все это ерунда, они шарлатаны, предложил мне обратиться к этим... которые ему натаскали этой фигни в подвал. Но его вариант меня не устраивает. Не хочу жить как в тюрьме. Еще неизвестно, кто шарлатаны.
  - Я понял. Значит, ради того, чтобы получить миллион и спасти свой разум...
  - Два миллиона, - перебил его Вадим. - Два нужно. У меня сын в Нижнем Новгороде. Ему три года. Мы не знали... я не знал, чем отец болен, он же секретность соблюдал!
  - И у сына тоже предрасположенность, - сказала мама, подражая его обреченному тону. Вадим злобно зыркнул на нее.
  
  
  Оценив расположение видеокамер, Сергей отступил в сторону и отвел за локоть маму, когда Вадим звонил в дверь. Света в окнах не было, но доктор Наталья открыла дверь почти сразу. На ней были блуза и домашние брюки, темные волосы заплетены в простую косу. Увидев на пороге троих вместо одного, она отшатнулась.
  - Все-таки выследили?
  - Доброе утро, Наталья Владимировна. Да, можно и так выразиться. Теперь, пожалуйста, проводите нас к вашему пациенту.
  Наталья встала перед ними в проеме двери.
  - Вам так поперек горла, чтобы Павла Георгиевича посмотрел Коссар? Вы хотели бы, чтобы он оставался таким? Подумайте!
  - Коссар?
  - Этьен Коссар из Каролинского института, - подсказала мама, - он сейчас в Москве, да. Но он же не консультирует, это я знаю точно, потому что... Вадим?!
  - Вадим сумел с ним договориться! Но она не хочет. Анна Ильинична, не обижайтесь, но ваша сестра... это комплекс сиделки в чистом виде, ей не хочется, чтобы мужчина перестал быть зависимым от нее. Честно, я не понимаю, почему вы, родственники, этому потакаете! Вы только представьте, а если Коссар ему поможет? Если он снова станет свободным, дееспособным...
  Она говорила четко, убежденно, Сергею показалось, что она давно и не один раз произносила эту речь в уме, и только строгий запрет или просьба любимого человека мешали высказать все это злодеям-родственникам. Он отвел руку в сторону, притормаживая маму, и сказал Вадиму.
  - А что, хорошо. Советую рассказать то же самое Хохлову, с необходимыми коррективами. Я готов подтвердить. А проверить будет не так-то просто, если вы скажете, что договоренность была частная, предварительная, - детали можно продумать.
  - Я вас не понимаю, - сказала она упавшим голосом. - Вы хотите все представить так, будто мы... Все это дело о похищении... Вадим, объясни им! Почему ты молчишь?
  Сергей обернулся на Вадима и встретил его умоляющий взгляд. Так он не смотрел даже у себя в комнате, когда выслушал его и убедился, что похищение провалилось. Но рассказывать женщине о страхе, который толкнул на преступление ее любимого человека, и вдобавок о ребенке в Нижнем Новгороде, Сергею не хотелось.
  - Вадим вам все объяснит, - сказал он Наталье. В конце концов, должны эти двое понести хоть какое-то наказание, верно, Островски? - Можно, мы все-таки войдем? Павла Георгиевича надо срочно отвезти домой.
  
  
  Наталья коснулась ключом замка и толкнула дверь. Тут же комната озарилась ярким светом, будто операционная, и человек, лежащий на кровати, съежился, обхватил голову, закрывая локтями лицо.
  - Пашенька, - позвала мама. Человек захныкал хриплым старческим голосом, мама опустилась возле кровати на корточки, стала уговаривать его, мягко трясти за плечо. Сергей тут же вспомнил, что необходимо позвонить Эдуарду, разбудить его и обрадовать, пускай активирует свою шайтан-машину, запускает какие нужно программы. Пока поговорил, мама уже подняла дядюшку на ноги и повела к двери. Шагал он неуклюже, и Сергей понял, что под спортивными штанами на нем подгузник, какой надевают лежачим больным. Слабоумный теребил пояс и хныкал, лицо у него было испуганное.
  Мама, молодец, нисколько не боялась, действовала спокойно и уверенно. Подумав так, Сергей понял, что сам... не то чтобы, но... в чем-то понял обвиняемого, скажем так. Желание оказаться как можно дальше, отдать что угодно, лишь бы не иметь к этому отношения, будто это заразно... а если не заниматься словесностью - страх.
  - Паша, все хорошо. Пойдем домой.
  - Домой, - отозвался человек, в котором Сергею трудно было признать давешнего веселого именинника. - Мне надо дом у меня там. Нельзя нельзя...
  Он посмотрел на Вадима. Тот сидел сгорбившись и сцепив руки в замок, и губы у него тряслись.
  - Ну хватит уже, - сказал ему Сергей. - Мужик... Будет тебе и диагностика, а понадобится - и лечение.
  Вадим ответил коротким ругательством. Сергей одобрительно кивнул и обернулся к маме.
  - Тебе помочь?
  - Открой ворота и подгони машину поближе.
  
  ***
  
  Обратно машину вел он, стараясь не прислушиваться к бормотанию на заднем сиденье. Что ты-то трясешься, Островски?! Ты арестовывал убийц, ты падал на Луну с трехсот метров, а наркоманов и электродников навидался еще курсантом. Почему тебя так пугает сумасшедший дядюшка?..
  Поселок был крошечный, все было близко, дело заняло меньше получаса, но синева приметно посветлела, - это уже можно было назвать утром. Он сам удивился, как радует его прибывающий свет.
  Снег все сыпал, у ворот на белой улице ярко выделялись две фигурки. Элегантное синее пальто тети Ляли и оранжевая курточка.
  Он ехал так быстро, как только мог решиться. С шипением поднялась передняя дверца, и он услышал тетю Лялю:
  - ...Немедленно пойдешь домой и будешь там сидеть, пока мы не придем!
  - Мама, я никуда не пойду! Хватит изображать из меня маленькую!
  - Пойдешь! Меня не интересует, что ты там разузнала, просто иди домой!
  - Сказала, не пойду! Папа, папочка!
  - Паша!..
  Мама помогла Павлу Георгиевичу вылезти, жена и дочка бросились к нему. Распущенные волосы падали тете Ляле на спину, ворот пальто без шарфа она зажимала рукой. Сергей увидел, что выражение тупого страха не исчезло с лица больного. А ведь поле должно добивать сюда....
  - Во двор, давайте зайдем во двор, - он сам плохо понимал, что говорит.
  - Паша? Паша?! Господи, нет же...
  - Спокойно, - вдруг сказала Алька. Голос у нее срывался, носик покраснел, но смотрела она не на отца, а на розовый планшетик в руке. - Мам, тетя Аня, будьте безмятежны. Есть коннект, идут обновления, сейчас, сейчас все будет...
  Опять стало слышно, как постукивает снежная крупа о рукав его куртки. Сергей вытянул шею, заглядывая в Алькин планшет, но тут окно на экране схлопнулось, открылось снова, его перечеркнула декоративная ярко-зеленая энцефалограмма...
  - Лялечка, что с тобой? - сказал дядя Паша. - Ты меня пугаешь! Пойдем домой, а то простудишься... Господи, который час?..
  Тетя Ляля молча прижалась к мужу, плечи ее вздрагивали. Серебристый камешек на браслете из жатой черной кожи светился голубоватым светом. Алькины губы поползли в стороны, на планшет упала капля.
  - Паааа-па! - взвыла большая девочка и тоже кинулась вперед, Сергей перехватил у нее планшет, чтобы не упал под ноги. Павел Георгиевич испуганно озирался поверх голов своих женщин, но теперь это был другой испуг - разумный и виноватый.
  - Алик, я и не видел, как ты приехала... Ага, Сергей, я вас узнал, здравствуйте. Анюта, хоть ты мне скажи наконец, что происходит?! Я отключился, да? Надолго?
  - Угу, - мама успела вытереть глаза и даже улыбнулась.
  - Вот чертовы железки, так и знал, что когда-нибудь... Я что-то натворил?
  - Да нет, в общем, нет, напугал только. Пошли домой, там все расскажем. И чаю, чаю!
  Мама и тетя Ляля взяли Павла Георгиевича под локти, он мягко освободился, перехватил их руки снизу, проворчав что-то насчет того, что у него слабая голова, а не ноги, и галантно повел сестричек к крыльцу; Ариадна бежала впереди. Сергей двинулся за ними. Пока шел, поглядывал в окно неизвестной программы. Не то чтобы он что-то понимал, но зеленые цвета и спокойный тон сообщений подсказывали, что все штатно. Он ткнул кончиком мизинца в меню, чтобы посмотреть время записи программы в память планшета.
  Чего и следовало ожидать. У Эда, как он ни старался оградить от лишней информации девичью психику, не было шансов. В конце концов, Алька - родная племянница моей мамочки.
  
  ***
  
  - Ложись и спи, - сказала мама. - Ты всю ночь не спал.
  Сергей вздохнул:
  - Мама, я не хочу спать.
  - Ерунда, сейчас захочешь. Белье свежее, я тебе принесла подушечку с хмелем...
  - С чем?
  - С шишечками хмеля, - мама показала ему пестрое лоскутное сердце, - и другими сонными травами. Что так смотришь?! Хмель, знаешь, с ним пиво делают.
  - Понял. А готовый продукт можно?
  - Не валяй дурака, куда тебе сейчас готовый продукт. Ложись, только сначала разденься.
  Мама сумела отыскать кнопку, которая опускает штору, и в мансарде теперь было сумеречно, как дома в детстве, когда болеешь на рождественских каникулах.
  - Я не усну сейчас, правда. А если усну, будут мучить кошмары.
  Мама бросила подушку на кровать, придвинула себе толстоногую табуретку и села.
  - Что это вдруг?
  - Мам, как там дядя Паша?
  - Тьфу-тьфу, никаких видимых отклонений. Эд запустил подробное тестирование, но крупных повреждений точно нет.
  - Ты ему рассказала, что случилось?
  - Рассказала. Он схватился за голову, потом выпил пятьдесят граммов, буквально через Лялькино "не пущу", потом снова схватился за голову и сказал, что страшно виноват перед Вадимом! Он, Пашка то есть, - перед ним виноват! Как это там - и сердце, упав на порог, спросило его: не ушибся, сынок?.. Ляля в ярости, конечно. Марина поздравила мать кислым голосом, и они с Витькой тут же уехали. Все-таки она сука, простите мой японский. Нина зато сияет, так ничего и не поняла.
  - А что Алька? С ней все хорошо?
  Мама развела руками.
  - Более или менее. Все живы, все вместе. Нет, знаешь, я думаю, Алька права, а моя сестра, ее мамаша - неправа. Девочка уже достаточно взрослая, чтобы ей не врали. И лучше знать наверняка, чем гадать, что скрывают родители. А то можно до такого догадаться...
  - А Вадим? Он не звонил тебе?
  - Не звонил. И если позвонит, скажу, чтобы не попадался на глаза Ляльке как можно дольше, а то получим еще одно семейное уголовное дело. Надо подумать, как ему забрать машину и вещи... Да, с Хохловым я поговорила, - он приедет завтра, просил тебя задержаться. Пашкиным кураторам позвонила, и в Питер, и в Москву. Они тоже обещали приехать завтра - его обследуют, поговорят с Лялькой насчет безопасности... - Мама наклонилась вперед и двумя точными движениями сбросила тапочки с его ног, вытянутых поверх одеяла. - Еще вопросы есть?
  Говорят ли крутые американские детективы: "Мама, посиди со мной еще немного"? Спать ему действительно пока не хотелось - подумаешь, ночь без сна, бывало и по две. Но настроение было странным, наверное, из-за вчерашней водки и алкодетокса. Такого у него не бывало с первых дел об убийствах. Открываешь глаза и видишь, что смерть, разрушение, небытие - не иной далекий мир, куда отправляются другие люди, преимущественно незнакомые, не статистика полицейского управления, не малоприятная часть важной работы. Это подкладка бытия, скрытая от глаз тонкой тканью, которая рвется каждый миг.
  - Мам. А если дядя Паша, не дай Бог, умрет, его сознание останется жить в этих компьютерах? Алька, тетя Ляля смогут с ним разговаривать?
  - Ох, какие ж вы дремучие, детектив Островски! - мама поцеловала его. - Конечно, нет. Это просто, ну... как слуховой аппарат, только для мозга. Без человека все это железо ничто.
  ...Но и человек ничто без этого железа. Пустая оболочка, выключенная лампа. Ни любви, ни дружбы, ни стихов и науки. Если отнять у нас память, систему связей между тем и этим, что останется?..
  - А ты уверена насчет Вадима, что у него нет этой болезни?
  - Уверена? Как это возможно? Я уверена, что предрасположенность к болезни Чена сейчас не ставится, до появления симптомов знать ничего нельзя. Я уверена, что нет ни одного случая манифестации болезни до сорока с лишним лет. Зато я знаю случаи, когда медики запугивали пациента с целью получить побольше денег. Выражаясь в манере Вадика, если что-то есть в нашей Америке, оно может быть и здесь... Ты заметил, какое у него было лицо там, у Натальи? А кто-то узнал, как он боится папиной болезни, и предложил ему спасение за смешную сумму, всего-то миллион... Паразиты.
  - Так надо позвонить адвокату и получить с них миллион, вместо того чтобы платить им.
  - Вот! Я спросила об этом Степанова сегодня утром, когда мы говорили насчет Паши, не называя имен, конечно. Степанов сделал так. (Мама скривила рот, выпятив нижнюю губу.) Не знаю почему, по-моему, дело выигрышное. Но у российских граждан есть предубеждение против судов. Ладно, я еще поговорю с Вадиком, пока я здесь, уточню, что за компания - называется Что-то-там-хелп, я не расслышала. Вадим Палыч, конечно, засранец и придумал гадость, но он был не в себе. И у Паши, получается, есть внук! Зачем же Вадька это скрывал? Если мать ребенка против, чтобы наша семья с ним общалась, мог бы хоть фотографии показать!
  - Он сукин сын, но это наш сукин сын, - сказал Сергей. - Франклин Рузвельт. Или Теодор?
  - Ну перестань. Нельзя требовать от человека, чтобы он не боялся сойти с ума.
  - Но можно требовать от человека, чтобы он не уничтожал других.
  - Ты же сам его жалеешь.
  - Да... И его, и всех. Я добрый сыщик, мам. У нас все будет хорошо?
  - Обязательно. В нашем роду сумасшествия не было.
  - Точно? - он улыбнулся, оттого что мама так легко его раскусила.
  - Точно. Не считая легкой придури. Бабушка мне рассказывала, что ее бабушка все время ловила в воздухе насекомых. Но гости не знали наверняка, что насекомых нет, они ведь бывают ОЧЕНЬ мелкими, так что все было о-кей. Лежи, я тебе принесу молока, с медом и коньяком.
  
  
  Когда Анна Островски открыла дверь, осторожно неся стакан теплого молока, ее сын спал одетый, под тонким вышитым покрывалом. Она погасила желтую лампу и вышла.
  Через пять минут Сергей вздрогнул во сне и открыл глаза. Некоторое время рассматривал узоры на деревянных дощечках у себя перед носом, слушая, как стучит сердце. Перевернулся на спину, полежал, глядя в потолок. Потом пошарил на тумбочке, взял вифон, запустил поисковик и настучал одним пальцем, не вставая:
  "клиника *хелп болезнь Чена диагностика профилактика Наталья Лебедева"
  Открыл первую ссылку, с информацией о консультантах клиники.
  Это могло быть и ошибкой, и ничего не значащим совпадением, думал он, разглядывая фотографию темноволосой женщины. Клиника, возможно, не та, и специалистов по болезни Чена не так уж много, и все знают всех, и все со всеми сотрудничают. Но пока это не проверено, дело нельзя считать законченным.
  Он подошел к окну, раздвинул пальцами тонкие планки шторы. В воздухе мельтешил снег, дымились трубы - люди топили печи, прогоняли холод зимы из маленьких домиков. Будто не знали, что в конце концов холод возьмет верх над каждым. А может быть, знали что-то другое, о чем редко говорят вслух.
  
  
  
  Аллея Славы
  
  Сергей Островски пересчитал официальные конверты во входящей почте. Одиннадцать. Счета, счета, счета плюс повторные уведомления. И как это случилось? Ну, съездил в Денвер, полазил по скалам, полетал немножко... да, курс джет-белтинга был дорогой, наверное, не стоило. В абсолютных числах все было пока не катастрофично, однако Сергей не любил, когда текущие расходы превышают доходы. Кредиты - зло.
  На что жил Шерлок Холмс? Кажется, ему и посетители не платили, чуть кого пожалеет, сразу говорит: не плати. На какую-то ренту или наследство? И еще у него была пчеловодческая ферма в Сассексе. А я, как назло, не люблю пчел.
  Сергей открыл свою рекламу, поводил курсором над текстом. "Если вы ничего не понимаете, жмите сюда". - Сыщик-интеллектуал, так тебя и так. Или ты, дорогой друг, летаешь над горами на ракете, прицепленной к заднице, или отказываешься расследовать супружеские измены. Две миллионерские привычки одновременно - это слишком. Противно следить за неверными мужьями и женами? Зато гарантированный результат и верные деньги. А мямлить квартирному хозяину "я работаю над этим" тебе не противно. Идиот.
  Квартирка была двухуровневая. Наверху жизненное пространство, пригодное для работы и захламления, на первом этаже офис детектива - лицензия в рамочке, награды и памятные вещицы, компьютерный терминал, удобные кресла, окна, как в прошлом веке, с бронированными шторами, и внешняя дверь такая же капитальная. На шторы-то и купился - солидный вид, посетители проникнутся... Два раза идиот. Еще бы в старом центре арендовал офис.
  Остатки денег, заработанных на Луне, мы не трогаем, разве что все пойдет плохо, в смысле, гораздо хуже, чем сейчас. А ведь мог бы продолжать служить в федеральном агентстве, карьеру делать... Ладно, стоп самоугрызениям. Не мог бы.
  Над списком входящих появилась новая строчка. Сообщение из формы обратной связи: некая Беатрис хочет встретиться лично. Ждет в чате. Хелло, Беатрис. Конечно, да. Вам удобно в моем офисе? Через десять минут, ОК. Я на месте, жду вас.
  Беатрис Лайон. Тридцать два года, возраст не скрыт. Родственники не указаны. Симпатичная, если верить студийному фото в профайле. Работает в телевизионной компании, ассистент креативного продюсера. Постит ссылки на телепередачи и смешные фотографии котов. Ладно.
  Сергей закрыл почту, вскочил с кресла, отловил и запер ползучего робота-уборщика, протер салфеткой пыльный стол. Огляделся - кажется, все прилично. Значит, так, интеллектуал: даже если она хочет узнать, кто сделал котят ее любимой кошке, ты соглашаешься, понял? Кстати, это нетрудно, безответственного отца можно найти в базе домашних питомцев. А вот если он дикий и его там нет... тогда с нее надбавка.
  
  ***
  
  Фото в профайле не соответствовало реальности. Симпатичная - абсолютно неподходящее слово. Это была красота, которая определяется не лицом и фигурой, а одеждой и манерами. Не фотомодель, на подиуме с такими параметрами делать нечего, - но любой собеседник этой женщины был благодарен за то, что ему улыбаются. Безупречный шелковый костюм, оттенка между легкомысленным почти-телесным и официальным кофейным, безупречно естественная прическа и такой же макияж. Рядом с этой безупречностью офис детектива-одиночки выглядел как плохо прибранный школьный класс, да все, что угодно, обнаруживало недостатки, которых она, однако, не замечала. Как будто ей и вправду все нравится. Милая полуулыбка, внимательный взгляд серых глаз - и приходится делать над собой усилие, чтобы не распластаться на животе, стуча хвостом.
  Она грациозно опустилась в кресло для посетителей - так, как будто это ее кабинет, а посетитель - детектив Островски.
  - Мне нужно, чтобы вы, как это называется, проследили за одним человеком...
  Любовник, обреченно подумал Сергей. Хотим знать, где этот тип обретается, когда следилка в вифоне показывает, что он сидит у себя в офисе, чьими духами от него пахнет и почему он стал так груб... Однако ж деньги мне нужны.
  - Что за человек?
  - Он мой сосед, - безмятежно сообщила она. - Его зовут Уиллард Адамс. Я живу на Джексон-стрит, сто девять, а он - напротив. Дом перешел мне по наследству, - добавила она со снисходительно-извиняющейся улыбкой, и Сергей тут же вспомнил этот район и эти дома в два-три этажа, голубые и кирпично-красные, с беленькими карнизами, якобы незатейливо выстроенные в ряд, как детские кубики. Пять минут к северу от того самого старого центра, где аренда не по карману ни детективу Островски, ни большинству налогоплательщиков.
  - Понимаете, он тоже работает в "Эй-Ти-Ви Стьюдиос", поэтому я его запомнила и обратила внимание, когда увидела, что он живет рядом. И вот тут, боюсь, мы подходим к сложному.
  - Я слушаю вас.
  - Последнюю неделю я работала дома. Время от времени выглядывала в окно - надо же иногда отдыхать, а смотреть ай-шоу я не могу, это как работать на шоколадной фабрике и есть конфеты... И вот, я заметила кое-что очень странное. Этот человек каждое утро уезжает на своей машине, каждый вечер возвращается. Но несколько раз он приезжал днем и тут же уезжал. И при этом переодевался.
  - Переодевался? Во что?
  - В одежду совершенно другого стиля. Знаете, у нас нет строгого дресскода, но никто в "Эй-Ти-Ви" так не одевается, потому что... ну, потому что такой одежды у наших сотрудников просто не может быть! Даже у низшего звена, а он продюсер. Я не узнала его, пока он не открыл свою машину пальцем, - он в тот раз припарковался на улице. То есть он забежал домой только для того, чтобы переодеться в этот ужас.
  Беатрис Лайон посмотрела на него, явно ожидая немедленной реакции.
  - Вы хотите сказать, что он был одет как-то эксцентрично, неподобающе?
  - Неподобающе, - согласилась она. - И сам он одевается совсем иначе, и вообще, никто у нас не наденет такое жуткое тряпье.
  Сергей покосился на свой пуловер, но взгляд миссис Лайон оставался ясными: присутствующие исключены, что позволено частному сыщику, не позволено продюсеру, или как-то так.
  - Но ведь у вашего соседа может быть хобби, - предположил он. - Пикник на свежем воздухе, прогулки в природном парке - там неуместен деловой костюм, верно?
  - Я плохо объясняю, - улыбнулась миссис Лайон, а прозвучало это как "попробую для совсем тупых". - Он как раз переодевался в костюм, но что это был за костюм, в этом все дело! Лиловый, ужасного лилового цвета! Сидел на нем жутко, как будто сшит из коробок для пиццы! И к лиловому снежно-белая сорочка и широкий светлый галстук.
  Сергей попытался представить эту страшную картину. Сам он не был большим специалистом по мужским костюмам (что, вероятно, следовало считать пробелом в профессиональной подготовке), но готов был признать, что деятели шоу-бизнеса и вправду одеваются по-другому.
  - То есть он был одет нарядно, но...э-э... нарядно по понятиям низшего класса?
  - Он был одет как администратор в магазине, - отрезала миссис Лайон. Тонкое различие между тем и этим было Сергею недоступно, однако основная идея понятна.
  - Действительно, интригует. Но законы штата не запрещают человеку переодеваться в плохой костюм. Может, он просто хотел кого-то разыграть?
  - Вот поэтому я и обратилась к вам, - сказала она. - Потому что законы не запрещают переодеваться. Полиция не прислушается к словам женщины, которой не нравится, как одет ее сосед. И я не сказала - он делал это по меньшей мере три раза, розыгрыш надоел бы и ему, и жертве, разве нет? А если полиция все же займется им и окажется, что он ни в чем не виноват, получится неловко. А главное, они мне ничего не расскажут, понимаете?! Может быть, они всё раскроют, но я так и не узнаю, куда он ездил!
  И точно, трагедия. Сергей не мог не усмехнуться в ответ.
  - Вы другое дело, вы частный детектив, я оплачиваю ваше время, и вы узнаёте для меня, зачем он это делает. Даже если он просто кого-то разыгрывает, я хочу знать подробности - кого и зачем можно так разыгрывать! Я посмотрела ваши расценки и решила, что лучше оставлю у вас сумму, которую обычно оставляю в спа-салоне. Мой косметолог говорит, что неудовлетворенное любопытство очень вредно для кожи.
  Отвечая любезностью, Сергей размышлял: принять ли это ее замечание как комплимент или подумать о том, чтобы поднять расценки? Глупо брать с клиентов столько же, сколько спа-салон. С другой стороны - это смотря какой салон...
  Беатрис Лайон сразу оплатила наружное наблюдение на пять дней вперед, проигнорировав его неубедительные протесты, и удалилась. Сергей со вздохом облегчения опустился в кресло и снова открыл счета. Квартирный хозяин и супермаркет могут получить свое, и, кстати, еды надо бы еще заказать. На неделю.
  
  ***
  
  "Событие, которое должно произойти, не происходит в присутствии специально снаряженного наблюдателя". Пять дней прошли впустую, если не считать оплаты. Уиллард Адамс из ATV вел упорядоченную жизнь без малейшей склонности к карнавальным переодеваниям. В первый день Сергей присматривал за ним из своей машины, потом представился случай подвесить ему "жучок" и миниатюрную камеру, в поле зрения которой попадал любой, кто садился на водительское место.
  Все напрасно. Каждое утро объект садился в машину и ехал на работу, каждый вечер возвращался. Один раз поужинал в ресторане - Сергей рванул туда, потратился на салатик и воду, и опять мимо - объект ужинал один и затем чинно вернулся на Джексон-стрит. Объект менял пиджаки и рубашки, а один раз надел серый длиннополый сюртук (Сергей встрепенулся, но это оказалась новая коллекция от Men"s), и неизменно оставался в границах хорошего вкуса.
  Оплаченное безделье начинало раздражать. Сергей детальнейшим образом исследовал личный и корпоративный блоги Уилларда Адамса - одинаково пресные и официальные. (Хотя как знать: может, в видеозаписи его выступления, где он призывал сотрудников проявлять инициативу и каждую минуту думать, чем лично вы можете помочь проекту, крылись страсти, неведомые посторонним? Но звучало все это нудно, и слушали его скорее вежливо, чем с бурлением инициативы.) Информации о проблемах и конфликтах было мало: то ли Адамс был везунчиком, то ли предпочитал хвастаться, а не жаловаться.
  В поисках уродливых костюмов или хоть какой-то зацепки Сергей посмотрел все проекты ATV на двух каналах, по серии или выпуску каждой, сначала те, продюсером которых был Уиллард Адамс, потом остальные. На четвертый день он зарегистрировался в анимированном шоу детективов, принадлежавшем одной из студий ATV, создал себе аватара - рыжего, конопатого, с ирландским акцентом, - удачно прошел первый уровень, раскрыв дело о похищении бриллиантового колье, получил двадцать пять лайков, три лава и приглашение участвовать в шоу-состязании с ценными призами. Адамс, чтоб ему было пусто, в очередной раз отбыл на службу и прибыл домой. В ответах Беатрис на отчеты детектива сквозило разочарование. Лето теснило весну, по вечерам в комнатке на втором этаже становилось душно, климат-контроль помогал мало. Сергей опять пробовал сидеть в машине, поближе к объекту, но в машине было не лучше.
  На пятый день, в половине девятого вечера, заорал звуковой сигнал, означающий движение в поле зрения видеокамеры. Сергей покосился на окошко программы, в следующую секунду вскочил с места, подхватил сумку и вифон и кинулся к двери.
  Лиловый костюм и белый треугольник рубахи на груди делали Адамса похожим на мультяшного кота. Он еще и прилизал волосы назад, открыв уши и залысины и полностью уничтожив модную прическу. Беатрис была права, к черту рассуждения о снобизме! Невозможно так себя изуродовать по случайной прихоти или по рассеянности - это могло быть только обдуманное действие.
  Зеленый огонек скользил по карте, указывая маршрут Адамса. Чтобы не мозолить ему глаза, Сергей ехал по параллельным улицам (спасибо тому, кто изобрел прямоугольную планировку). Шутки кончились, когда Адамс заехал на автостоянку. Повернув вслед за ним, Сергей еле успел увидеть прилизанную голову за лобовым стеклом выезжающего "форда". Логично: какой смысл переодеваться, если не меняешь машину?
  Пунктом назначения оказался район, вытянутый между автострадой и старой железной дорогой, - длинная полоса, застроенная одинаковыми кварталами. Район из тех, что "не принадлежат к числу наиболее преуспевающих", если цитировать городских чиновников. А если говорить правду, он вообще не принадлежит к числу преуспевающих. Чаще попадает в криминальные сводки, чем в рейтинги недвижимости.
  Здесь были полузаброшенные многоэтажные здания - что-то среднее между кондоминиумами и сквотами. Водопровод и канализация, как заверяли журналисты и пресс-служба мэра, в них действовали, а лифты работали не везде. Зато квартирная плата - чисто символическая. Сергей припарковался так, чтобы легко было последовать за Адамсом, куда бы он отсюда ни поехал, и переложил нейроствол из сумки в карман жилета. Обстановка располагала.
  Адамс переговорил с кем-то по вифону и принялся ждать. Слева, справа и впереди заслоняли небо черные прямоугольники многоквартирных домов; разноцветные окна светились этажа до десятого, дальше редели и над двадцатым вовсе исчезали. Небо между ними по-вечернему синело, внизу, в ущелье, было сумрачно - из четырех фонарей горел один. Переполненные мусорные контейнеры, цветущая чахоточная вишня, пустые качели и тренажеры, волейбольная площадка, одинокое велосипедное колесо, прикованное к парковочной скобе. Дальше компания у жаровни, от которой стелется сизый дым и тянет жареным мясом; человек десять, кто в желтом и алом, кто в черном и сером, а первая красавица племени, и вправду хорошенькая, если не придираться к фигурке, - в радужно-леопардовом "резиновом" комбинезоне. Лошадиное ржание, с переходом от визга до баса, неизобретательная ругань, тычки кулаками, и у кого нет парализатора, у того нож или кастет... Хорошо, что не я патрулирую этот квартал. И удачи тому, кто его патрулирует.
  Тот, кого ждал Адамс, вышел из единственного подъезда в дальнем от них доме. Он был в жилетке с капюшоном, лицо скрывала пленочная маска чешуйчатого инопланетника - видно только несколько прядей волос, скорее темных, чем светлых. Щуплый, по осанке и пластике - скорее молодой, чем пожилой. Сел рядом с водителем. О чем-то еще поговорили, машина тронулась.
  Преследование было коротким и несложным. Они остановились через пару кварталов у подъезда ночного клуба. Обычный клуб, со светящейся надписью "Hot Hot Spot", и ниже "вход только по приглашениям, приносим извинения и т.п.". Контакта для виртуального входа нет, или же он выключен. Стало быть, остается сетевой поиск.
  Через минуту Сергей откинулся на спинку кресла, вытянул ноги, насколько позволяли педали управления, и глубоко вздохнул. Специфика у закрытых вечеринок в этом клубе была вполне определенная, с год назад он фигурировал в новостях. Кто-то из участников не произнес вовремя стоп-слово, или произнес, но не был услышан, или ошибся с дозировкой препаратов, или, наконец, все подозреваемые и свидетели врали, но труп есть труп. Странно, что их не закрыли (или подобные случаи, напротив, укрепляют репутацию в определенных кругах?) Так или иначе, расследование можно считать завершенным. Это объясняет и переодевание, и смену машины - приличному человеку не захочется светиться в таком месте. И юный партнер из нищего района тоже вписывается.
  Бедная Беатрис. За ее деньги и наблюдательность - такая разгадка. Ни тебе страшных злодеяний, ни фантастических эскапад в духе Честертона. Неловко будет перед ней отчитываться, словно это я виноват, что Адамс оказался пошлым уродом. От души надеюсь, что он ей и вправду только сосед. Ну а если нет - не приходилось ли ей читать в книжках, что во многом знании многие печали?
  Сергей поднял на стекла 3D-пленку - теперь случайному прохожему машина покажется пустой. Все нам ясно или не все, но для порядка следует подождать, когда парочка выйдет.
  Вышли они в начале шестого утра, и в свете фонаря Сергей увидел, что парень по-прежнему в чешуйчатой маске. Инопланетник щелкнул зажигалкой, жадно затянулся. Адамс что-то сказал ему, тот дернул плечом, затянулся еще раз и отшвырнул сигарету, даже не делая вид, что пытается попасть в урну.
  Дождавшись, пока они уедут, Сергей вылез из машины и не спеша направился к белеющей на тротуаре добыче, незаметно расправляя герметичный пакетик. Плохо быть невоспитанным и необразованным. С тем же успехом ты, бестолочь в маске, мог оставить мне на память свою фотографию... А вот теперь попытаемся их догнать.
  
  ***
  
  Проводив клиента до дома, Сергей взглянул на часы. Было все еще неприлично рано, но YPLab принимала заказы круглосуточно. "Your Private Lab" - эксперты, выполняющие анализ почти любых объектов и биоматериалов, сфера услуг от банального установления отцовства до небескорыстной помощи адвокатам и частным детективам.
  Свет в фойе притушили процентов до тридцати, листья фикусов в кадках по углам казались серыми. На приеме заказов дежурила Лили. Дремала сидя, но, увидев постоянного клиента, тут же встрепенулась, подняла руки к волосам.
  - Сергей? - Во всем городе, наверное, только она называла ему так. Англоязычным он представлялся "Серж" - не то чтобы русское имя в эпоху глобализации было таким уж сложным, но с ударением на первый слог оно звучало как-то архаично и благочестиво. Лили ударения не путала. - Что-то срочное?
  - Лили, доброе утро. Да нет, как обычно, - он прислонился к барьеру, поставил на него локоть. Лили отклонилась назад и порозовела, смущенная посягательством на границу ее рабочего пространства. - Вот, принес тебе окурок. Конфетку забыл, извини.
  - Конфетку! Ты заплатил за прошлый заказ?
  - Конечно!
  Лили вытащила экран компьютера, провела по нему пальцем.
  - Да, действительно. Так что ты хочешь от окурка?
  - Сиквенс ДНК, все маркеры, поиск в полицейской базе. При отрицательном ответе - портрет. - Пальчик Лили постукивал по экрану, отмечая галочками выбранные пункты. - Обычные отпечатки пальцев пусть тоже будут, и что за сигарета. Степень опьянения, наркотики. Возраст - дорого?
  - Метилирование смотреть. Для тебя в этот раз скидка. Будешь заказывать?
  - Буду. И хранение образца, пока неделя. Пожалуй, на этом все.
  - Принято. Где ты его нашел?
  - В одном плохом месте. Тебе про такие и знать не следует.
  - Я бы рада знать только про хорошие. - В этом сарафанчике поверх блузки с цветочками, с этим хвостиком на затылке Лили выглядела такой юной и невинной, и так мило терялась, если задержать взгляд на ее лице чуть дольше, чем принято. - Но из хороших мест нам редко приносят работу.
  Сергей засмеялся, отметил в ежедневнике время готовности заказа и ласково простился с Лили. Начитавшись синопсисов телесериалов, он сформулировал для себя то, что давно подозревал. Флирт между мужчиной и женщиной, которых связывают профессиональные интересы, должен быть многообещающим, но без грубой прямоты, а развиваться ему надлежит очень-очень медленно. На протяжении нескольких сезонов как минимум.
  
  ***
  
  Он думал, что клиентка спит и проявится позже. Но Беатрис позвонила буквально через пару минут после того, как он отправил отчет.
  - Мистер Островски, спасибо вам, спасибо! Это больше того, на что я рассчитывала!
  - Я сам на такое не рассчитывал.
  Ни разочарования, ни отвращения. Радость, насколько можно судить по голосовой связи без картинки. Голос вовсе не сонный. Можно подумать, она всю жизнь мечтала узнать, что ее сосед извращенец, и ночь напролет, не смыкая глаз, ожидала эту прекрасную новость. Все-таки не любовник. Значит, конкурент, враг в служебных делах?..
  - А потом Адамс отвез того человека обратно, к нему домой? И сам уехал?
  - Да, я сопровождал его.
  - Я немедленно перевожу вам деньги. И, мистер Островски, мы можем прямо сейчас договориться о продолжении сотрудничества? Я отнимаю все ваше время, и если вы поднимете цену, я пойму.
  - Вы хотели бы, чтобы я проследил за кем-то еще?
  - Я хотела бы, - раздельно произнесла Беатрис Лайон, - чтобы вы продолжали следить за Адамсом. И за тем парнем, по возможности. Если надо, возьмите кого-нибудь в помощники.
  - Вы еще не удовлетворили любопытство?
  В наушнике раздался ведьминский смешок.
  - Мое любопытство только разгорелось!
  - Миссис Лайон, - сдержанно сказал он, - вы не хотите поделиться со мной дополнительной информацией?
  - Информацией?
  - Какого результата вы ждете от расследования?
  - М-м... Нет, не думаю. Понимаете, мне не хотелось бы, чтобы вы смотрели на это дело предвзято. Мне очень важно ваше впечатление.
  Клиент в своем праве, оставалось только попрощаться. Стало быть, все-таки не праздное любопытство...
  
  ***
  
  Когда работаешь один, у тебя нет времени ежедневно просматривать прессу и блоги - и нет права не делать этого. Дабл-ми у Сергея был надежный, дорогой и хорошо обученный. Хозяин не жалел на него времени, не реже чем раз в неделю старался погулять по Сети вместе с ним, напомнить, что действительно интересно, в первую очередь, во вторую и в третью, а что только притворяется таковым. Виртуальный секретарь-референт, исполняющий за хозяина тягомотную обязанность сетевого серфинга, - программка умная, но и самый умный исполнитель нуждается в инструкциях. Перед тем как лечь спать, Сергей просто докинул в список ключевых слов "Hot Hot Spot".
  Через четыре часа вифон встретил его красной вуалькой во весь экран и квадратиком уведомления с восклицательным знаком. Особой изощренности на этот раз не потребовалось. Клуб "Hot Hot Spot" занимал первые строчки в городских новостях.
  "Глава Хеликса любит погорячее"
  "Вот что вытворял Стенли Купер в ночном клубе (18+)"
  "Горячий поиск"
  Занятно: в то самое время, когда Сергей сидел в машине перед клубом, внутри зажигали не только Адамс с приятелем, но также основатель и гендиректор крупной компании, инвестирующей в информационные технологии. Человек-бренд. Хеликс - портал с кучей сервисов, поисковики, сетевые навигаторы и прочее. Кстати, виртуальный секретарь Сергея был как раз из их магазина. Штаб-квартира у Хеликса в столице штата, но сейчас Купер находился в Нотвилле, читал лекции и вел спецкурс в университете. И этой же ночью в клуб пробрались папарацци. Совпадение? Ха.
  Может, щуплый человек в маске алиена и был Стенли Купером? Не зря же он маску надел. Сергей вспомнил, как разговаривал с ним Уиллард Адамс из ATV, как приказал выбросить сигарету... Да нет, чушь: люди ранга Купера так не ходят и не держатся. И не тусуются в кварталах вроде того, откуда Адамс его забрал... А впрочем, что я о нем знаю? Многие великие компьютерщики были очень странными типами, высокий интеллект совместим и с социопатией, и с альтернативными пристрастиями. Однако более экономным будет предположение, что молодой человек работает на какой-нибудь дешевый новостной листок. Кстати, кто первым дал сообщение?.. Хм. Самый крупный портал с новостями города. Не думал, что их сотрудники живут в трущобах. Впрочем, автор хитовой новости может и не быть штатным сотрудником...
  От дальнейших умствований его отвлекло новое сообщение. Аккуратно закодированный пакет с результатами анализов от YPLab. Сергей убрал в сторону чашку с остатками кофе и увеличил экран.
  Хоть в чем-то продвинулись со времен старины Холмса. Не только марка сигарет (кстати, с марихуаной), но и много чего еще. Отпечатки большого и указательного пальцев. Не пил, не употреблял тяжелых наркотиков, следы марихуаны в организме присутствуют, что совсем не удивительно. В полицейских базах не числится. Возраст 20-25. Портрет...
  Сергей чуть не поперхнулся поджаренным хлебом. Всмотрелся внимательнее. Заглянул в Сеть, проверить, не мерещится ли. Не мерещилось. А вот в YPLab кто-то окончательно спятил.
  На вызов ответил Джо. Флегматичный, полноватый, лысоватый. Если это он, я очень удивлюсь.
  - Джо? Привет. Я получил результаты.
  - Что-то не так?
  Джо тоже ел на компьютерном экране - в руке бумажный стакан, рядом тарелка открытая, тарелка закрытая и упаковка с диетической мини-пиццей.
  - Ты знаешь, что не так.
  - Не знаю, честно! Серж, ты что? Ребята что-то напутали?
  - Да, можно и так сказать. У меня тут вместо моего фоторобота компьютерное изображение молодого Дэниэла Рэдклиффа. Мою сигаретку курил Гарри Поттер, юный волшебник, вроде того.
  - Подожди, - не переставая жевать, Джо завозил руками по столу. - Ну... Ты вот эту картинку получил?
  - Эту. Джо, отличная шутка, я оценил, но сейчас я бы просто хотел получить мой...
  - Так ее "вотчер" нарисовал. Именно эту. Вот, смотри, я тебе копирую мой экран. Видишь?.. Вот окно программы, вот все меню. Вот твои данные, номер заказа. Вот маркерные гены, которые удалось выявить, а удалось выявить почти все. Промежуточное построение по реперным точкам. Серый три-дэ без возраста. Он же с учетом возраста. Тонирование. Серж, ты напрасно думаешь, что кто-то у нас стал бы так шутить. И, по-моему, это совсем не смешно.
  - Хочешь сказать, человек, чью ДНК я вам принес, выглядит как Гарри Поттер?
  Джо посмотрел так, будто ирония до него не дошла. Была у него раздражающая привычка - говорить медленно и аккуратно, приставляя слово к слову.
  - Я бы сказал, что такое вполне возможно. Этот человек может быть из Аллеи Славы, как ты считаешь?
  - Причем тут Аллея Славы?
  - Ты не знаешь про Аллею Славы? Ты, частный детектив?
  - Все знают про Аллею Славы. Длинная, помпезная, звезды на тротуаре. Прости, я, возможно, не улавливаю твою мысль.
  - Возможно, - кротко согласился Джо. - Я имел в виду не ту аллею, которая в Голливуде, а несколько кварталов на северо-востоке Нотвилла. Это их неофициальное название. Подожди, ты что, правда не знаешь?
  Чувствовать себя идиотом полезно, но неприятно. Хорошо, что Лили уже ушла. Интересно, расскажет ей Джо или нет.
  К северо-востоку от скоростного шоссе, рядом с железнодорожными путями, располагался район - да-да, тот самый, Островски! - неблагополучный и неблагоустроенный. В конце ХХ века там случилось громкое отвратительное убийство, попавшее в энциклопедии и учебники. С тех пор - ничего особенного, преступность как преступность. Пока не произошла эта трагикомическая история, лет за тридцать до его переезда в Нотвилл.
  Все начиналось с благих намерений: социальная программа по профилактике и терапии генетических заболеваний. Внеплановые беременности у постоянных пар в то время стали редкостью даже среди социально незащищенных, а экстракорпоральное оплодотворение - обычной практикой. Кто-то подсчитал, что генетическая коррекция на этапе зародыша обойдется дешевле, чем социальное же лечение и страховые выплаты семьям больных детей, даже если учитывать только хромосомные патологии и моногенные заболевания. Тем, кто имел возможность участвовать в программе, но предпочел обойтись без нее, выплаты обещали урезать, что немало способствовало сотрудничеству.
  Программа работала нормально, в новостях красовались фотографии умилительных младенцев всех оттенков кожи. Удалось ли решить поставленные задачи по оздоровлению нации, Сергей не стал разбираться, для него сейчас принципиальным было другое.
  В одном медицинском центре группа сотрудников использовала профинансированную государством программу для криминальной схемы. Милая девушка или мудрый ученый доктор заговаривали с будущей мамой: мол, идеальное здоровье вашему дитяти обеспечено (до первого удара кастетом и первого кайфа, но об этом не будем), а теперь маленький бонус. Хотите, чтобы ребенок был похож на знаменитого актера? Да, очень просто, у нас есть база геномов. А для старых великих актеров, например, 50-х годов прошлого века, и для тех, до чьей ДНК мы не смогли добраться - реконструкции, не беспокойтесь, сработает как надо, мы знаем все гены, отвечающие и за нос, и за брови. Раз уж все равно делаем полное сканирование генома и редактирование мутаций, еще десяток-другой нуклеотидных замен никому не принесут вреда, а какие перспективы... Нет-нет, это уже платная услуга и не совсем официальная, а то многие захотят, хе-хе.
  Сергей с трудом понимал, почему жертвы соглашались. Вычислить нужные гены, действительно, не проблема, - это делает та же полицейская программа, что строит портреты по ДНК, только запущенная в обратном направлении. Внести изменения в геном тоже нехитро, тем более за счет государства. Но каким же надо быть лосем, чтобы поверить в эксклюзивность этой услуги?! А заодно и в блестящие перспективы. Впрочем, тогда еще не было закона о запрете на участие в шоу-бизнесе лицам с незаконными модификациями... А может, все дело в магии кино. Представь, что ты живешь в бетонной клетушке на десятом этаже, считаешь каждый доллар и видишь на экране Другой Мир, где почти такие же люди - всего-то несколько отличий в ДНК - встречают рассвет в океане на борту собственной яхты, ездят верхом и фехтуют на мечах, покоряют космос... Неужели ты не отдашь деньги, скопленные на новый монитор, чтобы купить ребенку билет в эти миры?!
  Отдавали как миленькие. Преступная деятельность продолжалась восемь лет. Восемь! Потом, очевидно, родители юных Аль Капоне и Орландо Блумов начали что-то подозревать: должны же они были встречаться на детских площадках и школьных концертах. Или кто-то проболтался кому не надо. Сами аферисты бесследно исчезли. Ареста, насколько понял Сергей, не было, и трупов этих деятелей тоже не находили.
  Теперь младшим из деток исполнилось по двадцать три года, старшим перевалило за тридцать. У них завелись свои дети, и те из них, чьи родители отказались от обратного редактирования, тоже походили на голливудовские прототипы, причем гораздо сильней, чем настоящие внуки знаменитостей (с внуком великого актера Сергей однажды имел дело, еще когда работал в полиции). Всего их было, когда афера накрылась, около пятисот. На сегодня в полицейских базах имелись данные о 374 лицах с отметкой "модифицированная внешность", а также о смерти трех лиц этой категории (огнестрел, нейроствол, передозировка). Неплохая статистика для северо-восточного района, если учесть, что в базе многие засветились с сущей ерундой вроде съемок в нелицензионной рекламе. Но было и незаконное хранение оружия, и применение оного. Девочки становились любовницами боссов, лидеров банд, оказывали эскорт-услуги; многим повезло еще меньше. Сергей вспомнил кучку людей у барбекю и хлопнул себя по лбу: у леопардовой девицы было личико Одри Хепберн. Слегка потасканной Одри, набравшей двадцать лишних килограммов Одри, но изящный носик, огромные глаза и брови как крылья - точно ее.
  Парни по большей части старались порвать с Голливудом. Сергей, приказав себе не ржать и не сквернословить, разглядывал фотографии, одну за другой. Это было похоже на странный кастинг для так и не снятого фильма. Популярные актеры последнего столетия один за другим пробовались на роль человека из низов. Старались изо всех сил. Кто-то глядел злобно, кто-то затравленно или безразлично. Один из Ди Каприо накачался и набрал вес ради вхождения в образ, другой болезненно исхудал, как электродник со стажем. Кому-то сделали впечатляющие шрамы и безумные прически, кому-то навесили колоритные немытые патлы. Потом, естественно, если фильм кассовый, а герой главный, он встряхнется, расправит плечи, обратит свои мысли к добру и всем покажет... Ага, как же. Фильм у нас сугубо реалистический. Артхаус и жестокая правда жизни.
  Еще Ди Каприо. Юный Шон Коннери. Эмма Уотсон (странно, что одна, при таком количестве Гарри. Хотя, может, это она в полицейской базе одна). Расселл Кроу. Крис Хемсуорт. Лайза Минелли. Клинт Иствуд... Попадались и незнакомые рожи: в ситкомах четвертьвековой давности детектив Островски не разбирался.
  Дэниэлов Рэдклиффов (или Гарри Поттеров: глаза у троих из них были зеленые, как бывают у кошек, и куда зеленее, чем у актера) в базе нашлось пятеро. После Иэна Бойда, также известного как Плохой Гарри, Сергей почувствовал, что эмоциональные реакции у него иссякли. Плохой Гарри весил, должно быть, как четыре средних человека, и он был черным. То ли родители у него была еще глупее, чем у остальных, то ли не хватило денег на инактивацию генов, вовлеченных в синтез меланина, а может быть, аферисты решили поразвлечься и не все объяснили клиентам, но острый нос и дугообразные брови мальчика-волшебника на толстой морде шоколадного цвета смотрелись запредельно. И, да, он носил очки. С простыми стеклами, для прикола. А в базу попал за жестокое избиение подруги. Интересно, белого Моргана Фримена среди них нет?
  По крайней мере, тот, кто был с Адамсом, - не Плохой Гарри. Место проживания, допустим, могло поменяться, но телосложение явно не совпадает. И хорошо. На самом деле спутник Адамса не может быть никем из этих пятерых, раз его нет в базе. Сколько же их всего, хотел бы я знать?..
  Что говорить, вечеринка удалась. Стенли Купер, Гарри Поттер и продюсер телекомпании - такое в "Hot Hot Spot" едва ли видели раньше. Странно, что новостники не упоминают Гарри Поттера. Виртуальный магнат оказался не только любителем BDSM, а, возможно, еще и фикшн-сексуалом - как они могли это пропустить? Или Гарри Поттер тихо сидел в уголочке? Но тогда зачем его привезли?..
  Стоп. Сергей уменьшил окно с базой и вернулся в новости.
  Он так и не открыл ленту компрометирующих фотографий - заленился подтверждать свое совершеннолетие. И он понятия не имел, как выглядит Стенли Купер. Зато знал, сколько ему лет: 28, на три года меньше, чем ему самому (про это однажды сообщила мама, с обычным намеком: мол, пока некоторые бегают за жуликами и по бабам, хорошие мальчики и т.д.). Вырос в Нотвилле и не любит разговаривать о своем детстве, видимо, трудное оно было, как у всех вундеркиндов...
  Подтверждение прошло. В кадре, прикованный к высокой перекладине наручниками (вероятно, с мягкой подкладкой в браслетах, а может, и нет), облитый металлическим синеватым светом, красовался Дэниэл Рэдклифф. Обнаженный до пояса и одетый во что-то вроде ременной шлейки, почти висящий на руках. В весьма непривычном образе, так что без предупреждения можно и не узнать: коротко, под машинку, остриженный, и с такой же бородкой-щетиной. Глаза зеленые, а может быть, светло-карие. В ухе поблескивает дорогая гарнитура от вифона. Ну вдруг из компании будет срочный вызов, а руки заняты.
  Великий человек не любил персонального пиара, интервью с фотографией пришлось поискать. Нашлось двухлетней давности, как раз из тех времен, когда Хеликс начал появляться в поисковиках чаще конкурента. Глаза зеленые. Гарнитура в ухе другая - знакомый общедоступный бренд, голова выбрита под ноль, но бородка уже отросла. А вообще очень похож. И на актера. И на фотографию в наручниках. "Вы начали интересоваться IT еще в школе?" - "Другой вопрос, пожалуйста".
  Уши и форма черепа? Генетические аферисты наверняка не трудились подгонять такие детали, а детали-то важные для криминалиста, хотя и подзабытые в эпоху ДНК-идентификации... Хм. Мочка приросшая, как и у прототипа. Общая форма, завиток и противозавиток похожи на обеих фотографиях. Разглядеть козелок и противокозелок мешает гарнитура.
  Если верить видеокамере на его машине, Адамс мирно спал дома. Сергей потратил пару минут, чтобы перекинуть слежку ассистенту, специально прикормленному для подобных работ: тот, по счастью, был свободен. Затем опустил экран, потянулся и встал, ища глазами рабочий рюкзак. Тот, другой, наверное, тоже спит дома.
  
  ***
  
  Теперь ущелье было раскаленным. Жара опустошила двор, лишь несколько бездельников в темных очках валялись на скамейках у волейбольной площадки, да в облупленной "чашке", укрытой тенью дома, гоняли двое пацанов - выписывали сложные кривые, грохая досками на разворотах. Третий сидел рядом на вросшем в землю бетонном блоке, держал коленками слидборд. Серебряная кайма с гнездами уже была приклеена по краю, и мальчишка, сосредоточенно сопя, вставлял в них светодиодики. Мазнул ладонью по нижней стороне, огоньки вспыхнули.
  - Класс, - сказал Сергей. Мальчик вскинул голову, прикрыл ладошкой коробку со светодиодами. Увидев незнакомого взрослого, слегка успокоился.
  - Одни красные ставишь?
  - Красные и пурпурные, два через два. А чего?
  - Дорогие, да?
  - А ты чего хочешь, ты?
  - Ищу одного чела, - Сергей присел рядом, на безопасном, с точки зрения собеседника, расстоянии. - Он вон в том доме живет.
  - Там до хрена народу живет.
  - Похож на Гарри Поттера.
  - Ха. Я там троих знаю гарепотеров.
  - Мне нужен тот, который волосы стрижет машинкой, по-армейски. И еще он бороду носит, короткую.
  - Вроде знаю. - Мальчик весь ушел в работу. Сергей постучал его пальцем по плечу и показал экран вифона, на котором уже висел черно-белый "лоскуток" - быстрый анонимный доступ к платежу. Дитя заинтересовалось, потом задумалось.
  - Десять баксов?.. - Изогнувшись вбок, мальчик потащил свой вифон из кармана. "Глаз" на монитор, картинка исчезла. - Ну-у, это, наверно, Стив с седьмого. Сын мистера Грейвза. Я че-то стремаюсь, а зачем он тебе?
  - У нас с ним дела. Я ему деньги должен отдать.
  - Так он сам тебя найдет?
  - Не, не катит. Ну? Стив с седьмого, а дальше? Какая квартира?
  - Дальше... а вот, видишь, идет с бутылями? Мэгги. Это его девушка. Спроси ее.
  - Думаешь?
  - Точняк.
  Мэгги, девушка Стива, шла к маленькой площадке у водопроводного крана, торчащего из стены. В каждой руке по большой пластиковой фляге. Маленького роста, в узкой майке и широких штанах как будто на пару размеров больше. Волосы кудрявым облаком из-под желтой банданы, на спине рюкзачок, из него торчит горлышко такой же фляги с петлей для переноски. Сергей пошел к ней, стараясь выглядеть как можно более безобидным.
  - Эй, наверху опять воды нет?
  Она обернулась. Личико сердечком, правильные черты, можно даже сказать, что хорошенькая. Тоже из этих? Милая юная американка, положительная героиня... Фэй Данауэй - Бонни Паркер... Ладно, не выдумывай. Иногда девушка - это просто девушка.
  - Почему? Есть вода, как обычно. Бурая, чашка за десять минут. Проблемы?
  Незнакомым здесь не улыбались. Знакомым, наверное, тоже не всем. И показной безобидности не верили.
  - Слушай, - струя воды с шумом била в бутылку, говорить приходилось громко, и он подошел ближе. - Ты Мэгги?
  - Ну?
  - Я ищу Стива. У меня деньги для него.
  Вода вырвалась из горлышка, брызги полетели на майку девушки. Она закрутила кран, сердито обернулась.
  - Чего? Какие еще деньги?
  - Серьезные, - в тон ей ответил Сергей. - Ты знаешь, где он?
  - Он переехал, - Мэгги подняла вторую флягу, отвернула кран. - Здесь больше не живет!
  - Да ладно! Вчера еще был!
  (Или все-таки мы говорим о разных гарепотерах?..)
  - И сегодня еще был, - ответила Мэгги. - Сегодня утром вызвал меня и сказал, что переезжает.
  - Не сказал, куда?
  - Сказал. Я думаю, если ты ему нужен, он сам тебя найдет.
  - Послушай, Мэгги, - Сергей заговорил как мог проникновенно, - если я сегодня не найду его, я в заднице. Это и его интерес, и мой, но деньги не мои, я курьер, понимаешь?
  - Хм, - только и ответила Мэгги, однако это был понимающий "хм". У Сергея были планы, как отвечать на дальнейшие вопросы, например, от кого деньги. Но женщины прекрасны тем, что сами себе все объясняют.
  - Давай так: я помогу тебе отнести наверх эту воду, а ты меня свяжешь со Стивом. Ты ему позвони, а я при тебе с ним поговорю, годится?
  Вот теперь она улыбнулась краешками губ.
  - Двенадцатый этаж.
  
  
  Через пять минут Сергей подумал, что легче было бы подняться на двенадцатый по наружной стене. Пусть даже с флягой в рюкзаке. Там хотя бы ветерок. Как девчонка собиралась тащить все три фляги?
  В этом сквоте не было не только лифта, но и кондиционера. И уборщиков. И совести у жильцов. На лестничной клетке их встретила духота, по сравнению с которой жара на улице казалась прохладой, - солнце раскаляло стену. Под ногами хрустела какая-то дрянь, пахло гниющим мусорным баком, мочой, пролитым пивом. На третьем этаже потянуло жареным карри. Мэгги неторопливо поднималась, держа свой рюкзачок за лямки, чтобы не резали плечи; шлепанцы щелкали по босым пяткам. Прямо как в сказке принцесса каждый день выносила из дворца любимого теленочка попастись на травке, пока удивленные царедворцы не увидели, как ея высочество тащит на плечах быка. Мораль: человек ко всему может приспособиться... Граффити на стенах. Шприцы и бумажки от нейрочипов на полу. Нераспечатанный раздутый пакетик кукурузных хлопьев, ожидающий ветерка, чтобы продолжить спуск по ступенькам...
  Все слышнее музыка, кто-то играет на гитаре. На площадке между четвертым и пятым этажом сидит девочка-азиатка, прямо на полу, будто уличный музыкант: "Барселона, о-у-о, Барселона..." Мэгги перемигивается с ней. Двумя этажами выше обратная ситуация: в рваном кресле, похожем на кучу тряпья, сидит старик с веснушчатой лысиной, читает толстую бумажную книгу, а из-за двери доносится ритмичный грохот. Мэгги здоровается, старик отвечает невнятным хмыком. С каждой ступенькой все жарче, струйки пота щекочут лоб и шею.
  - Погоди минутку.
  - Чего?.. А, ну давай посидим. Я всегда тут сижу.
  Они уселись рядом на верхней ступеньке. Стену напротив украшала пятиконечная звезда с кружочком внутри и ругательством в кружочке. Звезда что-то напоминала... точно. Аллея Славы.
  - Мы уже прошли его квартиру?
  - Ага. На седьмом, слева. Там сейчас его отец и сестра с детьми.
  - Может, мне с ними поговорить?
  - Если ты отдашь деньги его папане, Стив их точно не увидит.
  - Пьет?
  - Нет, просто сукин сын. - Мэгги поддала ногой пластиковую банку - бэнц! - банка улетела в шахту лифта, через раскрытые створки.
  - У вас тут не убирают, что ли?
  - Почему? Убирают каждый понедельник. Ладно, пошли.
  Когда они миновали десятый этаж, Мэгги неожиданно повернулась.
  - Стой тут и не высовывайся, чтоб тебя не видно было. Я сейчас.
  Оставив Сергея на лестнице, она сбежала вниз, к квартирным дверям. Верещание звонка, звук открываемой двери. "Добрый день, бабушка Дру! Ваша вода!" - "Благослови тебя Бог, деточка, благослови тебя Бог!" - "Ага. Я потом еще зайду" - "Благослови тебя Бог..."
  Дверь захлопнулась, Мэгги взбежала вверх, помахивая пустым рюкзачком.
  - Порядок, теперь пошли. Бабушка Дру хорошая, я ее люблю, но если тебя увидит, задолбает своим "что это за молодой человек".
  Задолбает. Сколько же тебе лет, девочка, подумал Сергей, но спросил другое:
  - Она твоя бабушка?
  - Она - просто - бабушка, - раздельно произнесла Мэгги. - Всё, пришли. Сейчас я ему позвоню.
  Вытащила маленький вифон, прижала к уху. Сергей услышал гудки. Три. Четыре. Пять.
  - Странно. Он не отвечает.
  - Ну, мало ли что.
  - Он всегда отвечает. Если не может говорить, посылает "ждите".
  Мэгги снова послала вызов. Вид у нее был обеспокоенный. Снизу доносился гитарный звон.
  - А может быть, он спит?
  - Когда спит, ставит "сплю".
  Видимо, вифонная связь для этих двоих имела большое значение. Сергей принял несчастный и обреченный вид, обдумывая следующую реплику.
  - Слушай, ладно, - вдруг сказала Мэгги. - Сто пятнадцать, Двадцать вторая улица. Квартира десять. И передай ему, что Мэгги ждет звонка.
  - Спасибо. Знаю Двадцать вторую. - Сергей действительно знал. По сравнению с Аллеей Славы это был прыжок в небеса. - Дела у Стива неплохие, э?
  Мэгги пристально посмотрела на него.
  - Тебе виднее.
  
  
  Девочка на четвертом все играла, когда Сергей спустился на седьмой. Спускался он медленно, освежая в памяти нужные обороты речи.
  - Чего надо? - ответили из-за двери.
  - Добрый день! Я из департамента социальной защиты. (У Сергея была визитка, практически неотличимая от настоящей.) Могу я видеть Стивена Грейвза?
  - Он здесь больше не живет!
  - О, как же так? Мне дали этот адрес!.. Послушайте, он ваш родственник? Я по вопросу выплат... Можно мне зайти?
  Дверь приоткрылась, выглянула полная молодая женщина. Морщась и хмурясь, оглядела Сергея и его визитку. В квартире был на полную громкость включен телевизор: судя по веселенькой музыке и нечеловеческим воплям - несертифицированный круглосуточный детский канал. Женщина освободила ему проход и махнула рукой вперед по коридору. Кондиционера в квартире тоже не было, и судя по запаху, смыв в туалете работал неважно. А в остальном жилье как жилье. Разноцветные плакаты на стенах, пол покрыт краской под дерево, и там, где она вытерлась, по маршруту "комнаты - ванная - кухня", просвечивает бетон.
  - Паааааап!
  Кажется, Стив был похож на отца не больше, чем Гарри Поттер на мистера Дурсля. То ли мастерство медгенетиков было велико, то ли имелись и естественные причины.
  - Здравствуйте, я из департамента социальной защиты. Стивен Грейвз - ваш сын?
  - Ну. (Или какой-то похожий звук, теоретически - подтверждение.)
  - Он принадлежит к числу лиц с модифицированной внешностью?
  - Я не понял.
  - Папа, да! - крикнул женский голос, перекрывая мультяшную возню. - Он имеет в виду, что Стив...
  - Иди и сама говори! - огрызнулся отец. - Да, он из этих. И что?
  - Согласно новому постановлению управляющего совета, лицам этой категории начисляются выплаты, как компенсация ущерба от действий мошенников, с возможностью потратить эти деньги на обучение и улучшение условий проживания. Однако выплаты предоставляются лишь тем, чей ежемесячный доход не соответствует второму уровню социального благополучия. Вы могли бы сказать, какая сумма приходится ежемесячно в вашей семье на одного человека?
  - А он тут причем? Он совершеннолетний, сам зарабатывает. В кафе на заправке с подносами бегает.
  - Приблизительно сколько он зарабатывает?
  - Не знаю сколько и знать не хочу. Со мной не делится. Компенсация ущерба... мне кто бы выплатил компенсацию ущерба! Его мать была идиоткой, ничего не смыслила в жизни...
  - Папа, прекрати!
  - Сама заткнись! Вместо сына родила мне гарепотера. "Эй, Грейвз, а на кого похож твой сын?" - мне кто-нибудь за это заплатит, объясни, если ты такой умный?
  - Это важный вопрос, думаю, его стоит обсудить...
  - Вот когда обсудите, тогда и зайдешь. Это все?
  - Прошу прощения, нет. Стивен Грейвз живет здесь, с вами?
  - Нет, - злорадно сказал мистер Грейвз. - Всегда болтал про то, как мы ему осточертели и как он мечтает от нас съехать. А куда он съедет - друзей у него нет, чтобы вместе снимать, шлюшка его сама живет с родителями и не работает, в очереди стоит. Орал, что наймется в мясной инкубатор!
  - Простите?
  - Да пожалуйста! Лучше, говорит, работать с китайцами и спать в капсуле, чем с нами жить. Я ему за это и врезал как следует.
  При упоминании капсул Сергей сообразил, о чем речь. Всякому человеку нужно на кого-то глядеть сверху вниз, а социальные лифты работают даже там, где бездействуют обычные. Этажом ниже Аллеи Славы располагались заводы сетевых ресторанов быстрого питания "Доктор Спринг". Дружественные к природе и особо полезные для здоровья гамбургеры, выращенные в биореакторах, считались едой для невзыскательных потребителей (тем не менее каждый горожанин хоть раз да попробовал их). Это же касалось и трудоустройства: на заводах "Доктора Спринга" работали в основном иммигранты, легальные и, вероятно, нелегальные. Санитарные нормы и социальные гарантии там соблюдались, по крайней мере, нарушений пока никто не выявил, да уж очень рационально-экономичной была система эксплуатации труда. Если можешь сэкономить на рабочем цент, не вступая в конфронтацию с законами, - вперед.
  - Но он все-таки туда нанялся?
  - Не знаю, куда он нанялся! Мне не доложился! Новый адрес свой назвал: где-то на Двадцать второй, я не записал. Надо ему будет - сам объявится. Всё?
  
  ***
  
  Солнце все еще стояло высоко, дырчатая тень липовой кроны не дотягивалась до входной двери. Дом 115 по Двадцать второй был таким же, как дома справа, слева и напротив: темно-красный кирпич, пять жилых этажей над гаражами и магазином, три подъезда. Здесь жили студенты и "молодые трудоустроенные профессионалы", не имеющие богатых родителей. Сергей набрал "десять" на пульте - хозяин был дома, если верить зеленому огоньку. Вызов. Сигнал, еще сигнал. Никакого ответа.
  Странно. Знаю я, как в этих многоквартирных домах орет вызов. Даже если ты пьян как скунс - очнешься хотя бы настолько, чтобы отключить это бзз-бзз-бзз... Ага, вот именно это!
  Сергей поднял голову. Жужжание вызова доносилось сверху, из приоткрытого окна на третьем этаже. Приоткрытое окно в середине дня, когда все нормальные люди окна закрывают и включают климат-системы. Даже отсюда звук сигнала въедался в уши, гудение кондиционеров и шум Рочестер-стрит его не заглушали. Двадцать вторая была пуста. Ни человеческого голоса, ни музыки из окна. Только настырное бзыканье над головой, и давящая жара, словно бархатную портьеру накинули тебе на голову...
  Почти забытое ощущение. Не то чтобы тошнота, а так, секундный ступор, неподобающий стражу закона и порядка, и потом ясное понимание: опять оно. Вольным частным детективам не полагается напарников и подчиненных, которым можно ненавязчиво уступить удачу. Остается покончить с этим как можно быстрее.
  Нажав сброс вызова, Сергей несколько секунд постоял неподвижно, потом повернулся к машине. Там он оставил, помимо рюкзачка с оборудованием, перчатки и тапочки с "гекконами". По правилам, следовало обращаться в службу безопасности здания, начать обычную процедуру... Но хозяин - дома. И говорят, что обычно он всегда отвечает на звонки.
  Ворота гаражей оказались антилипкими, пришлось цепляться за узкий простенок между ними. Вдобавок жилые этажи слегка нависали над нижним и были окаймлены карнизом: вора квалификацией пониже, не умеющего лазить по отрицательной кривизне, это могло бы остановить. Выше пошли антенны и радужные цветочки солнечных батареек. Где те пожарные лестницы старых добрых многоэтажных домов, сыгравшие в стольких гангстерских фильмах...
  - Эй, что вы делаете? Немедленно спускайтесь!
  А какая пустая была улица только что.
  - Моему другу плохо, он не может подойти к двери! - крикнул Сергей в ответ. До окна оставалось два рывка вверх.
  - Я вызываю полицию!
  - Хорошо!
  То есть хреново. Явно и окончательно хреново. Сергей как раз повернул оконную раму и с первого же вдоха понял: лез не напрасно. Окно открылось шире, ветерок потащил по паркету комочки пыли, скомканную салфетку, клок волос.
  Это была спальня, и в спальне был труп. Сюрприз состоял в том, что это не был Дэниэл Рэдклифф... тьфу! Это не был ни Стивен Грейвз, ни Стенли Купер, и никто из их братиков. Совершенно незнакомый человек, русоволосый, плотного телосложения, умерший от удушения тонкой черной веревкой, в рубахе с короткими рукавами и без штанов. Правда, судя по некоторым предметам, валяющимся на полу, мог посещать тот же клуб. Если предметы принадлежали ему. И убийство, что окончательно ясно со второго взгляда, - на сексуальной почве.
  Первым делом Сергей снял рюкзак и выпустил своих флайботов. Они только посмотрят и поснимают, от полиции не убудет. И пока они строились по порядку, - как честный гражданин, набрал на вифоне код полиции, номер своей лицензии, адрес дома и код убийства. Затем поменял перчатки - "гекконы" в карман, пластик на руки. В спальне он пробыл недолго: оставил сцену преступления летучим друзьям и прошел в гостиную, она же кухня и столовая.
  Не было похоже, что жилец вселился сегодня утром и урвал максимум пару часов перед тем, как убить гостя. Тонкая рубашка на спинке стула - с характерными складками на рукавах под локтями, надеванная. Раскрытый двустворчатый планшет-читалка, рядом на столешнице пересекающиеся кольца - следы от стакана. Сергей открыл холодильник. Три контейнера с таймерами на крышках, все показывают разное время годности. Коробка из-под большой пиццы, в ней два куска. В этой квартире живут давно. Значит, есть второй жилец, - может быть, тот самый удавленник? Но спальня одна, и, прямо скажем, на двоих тут ничего не рассчитано. Разве что на очень бедных или находящихся в очень интимной связи.
  Тут изыскания пришлось остановить: прибыла полиция. Четверо, в том числе детектив и эксперт по IT. Детектива звали Джеймс Уильямс, был он молод, серьезен и снисходителен. Они с Сергеем знали друг друга по именам, теперь повезло пересечься на работе. Будь тут полицейский постарше, он бы, может, обрадовался, что при трупе имеется человек, который уже что-то знает и готов делиться информацией, пусть и с оглядкой на интересы своего клиента. А Джим смотрел как кобель, на тщательно размеченную территорию которого проник чужак.
  - Серж, - преувеличенно церемонный наклон головы. - Нам был звонок, ты по стене сюда влез? Круто, но стоило ли? Привлек лишнее внимание.
  Иногда Сергей завидовал русским понятиям о возрастной субординации, дескать, младший старшего не зовет по имени и не дает непрошеных советов.
  - Стоило ли? Я сэкономил час времени, а если бы меня здесь вообще не было, вызов мог поступить и через сутки. Ты, наверное, хочешь спросить меня о чем-то еще?
  Молодой поморщился, однако передумал спорить или сам сообразил, что время дорого.
  - Что тебе здесь понадобилось?
  Сергей коротко рассказал - Уиллард Адамс и его спутник из Аллеи Славы в "Hot Hot Spot", инцидент со Стенли Купером, идентификация портрета по ДНК, разговор с Мэгги, этот адрес. Джим слушал его, глядя то в вифон, то на экран лаптопа, и бубня команды. Придираться к этому было бессмысленно: теперь над трупом реяли его флайботы, а техник разбирался со смартхоумом.
  - А кто твой клиент? - наконец спросил он.
  - Работает там же, где Адамс. Имя назову, когда возникнет обоснованная необходимость, - ты понимаешь.
  - И ты думаешь, что этот твой Стив тут жил?
  - Его девушка сказала, он сюда переезжает. Но теперь я уже так не думаю. Кто бы тут ни жил, он въехал не сегодня.
  - Что значит "кто бы ни жил"? Квартиру арендовал убитый, Тимоти Пирс, студент университета.
  - А этот мой Стив? Что говорит смартхоум, видео?
  - Последний вызов от входной двери в четырнадцать двадцать семь - твой?.. Я так и понял. А перед этим только утром. Причем открыли хозяйским ключом, но вошел не он, хозяин был дома - пришел накануне вечером, открыл пальцем.
  - Дай посмотреть на утреннего.
  - Ну-у, я на самом деле не уверен... - протянул Уильямс, напомнив Сергею пацана со слитбордом. Интересно, я был таким же мерзким, когда служил в полицейском управлении?
  - Джим, - сказал он, - если честно, это нужно тебе. У тебя подозрительный визит к твоему покойнику и свидетель, который может прямо сейчас опознать посетителя. Итак?
  Ты не свидетель, ты частный сыщик и плевать хотел на все, кроме своей выгоды, очень громко подумал Джим. Но все же повернул к нему лаптоп.
  На экране был Стив. По крайней мере, человек, похожий на Дэниэла Рэдклиффа, щуплого телосложения, в жилетке с капюшоном (капюшон теперь откинут, на голове бейсболка) и с большим рюкзаком за плечами. Камера находилась над лифтом и снимала немного сверху, но лицо было хорошо видно. Спокойное, несколько сонное лицо.
  - Он. А когда ушел?
  - Через пятнадцать минут. Ну, посмотри, если хочешь, но тут лицо почти не видно.
  Действительно, теперь он был виден со спины. Вывалился из лифта, ссыпался по лестнице через две ступеньки, не сразу попал ключом в контакт. Обернулся, кажется, на какой-то звук - острый профиль, черные вихры из-под бейсболки, рот полуоткрыт, как в удушье.
  - Кто еще к нему приходил?
  Джим насмешливо сморщил нос.
  - Больше никого! В другие квартиры - да, но после того как покойный вернулся домой вчера около восьми, в десятую звонили только этот тип и ты.
  - Так что, объявляем его в розыск?
  - Не думаю, - высокомерно сказал молокосос. - Хотя, учитывая твои показания, стоит проверить его местонахождение. Но более вероятно, что здесь побывал совсем другой человек. Похожий на него, как ты верно заметил. Давай посмотрим вот тут...
  В квадратике ухо убегающего. Зум, еще зум, максималка. В ухе дорогая гарнитура. Шарик с перламутровым блеском, мягкий зажим на хряще, причудливо изогнутый усик антенны. Совсем недавно я такую видел.
  - Эксклюзив от "Айю", ограниченная серия, - сказал Джим. - Я запросил фирму. Смотри, вот она, у них на витрине. Цена по запросу, возможность голосового ответа шепотом. Так вот, одним из покупателей был Стенли Купер.
  - Но это может быть копия?
  - Копия?! Серж, их всего двадцать штук, и больше нет нигде, ни за какие деньги. А чтобы сделать нелегальную три-дэ-копию, надо иметь оригинал, там есть хитрости. Как ты это себе представляешь - злоумышленник подойдет к Куперу и попросит у него гарнитуру из уха? А может, заодно пару зубных имплантатов и пароль от вифона?
  Сергей не нашел, что ответить. Если он прав, то чертова гарнитура - для Нотвилла большая редкость, чем сходство с Гарри Поттером. А вдруг и в клубе был все-таки он? Гарнитура же была...
  - Ты сам веришь, что Стенли Купер - любитель экстремального секса и убийца?
  - Серж... - Это прозвучало как-то знакомо. Уильямс копировал издевательски-доверительную интонацию, с которой детектив Островски излагал свои соображения. Не то сознательно передразнивал, не то бессознательно обезьянничал, и Сергей не мог понять, что обиднее. - Серж. Веру мы оставим читателям новостей и поговорим о доказательствах. Купер мог быть тем посетителем на видеозаписи. Гарнитура, несомненно, принадлежит ему. Образцы биоматериалов убийцы мы отправим на экспертизу - других доказательств достаточно, чтобы нам получить доступ к его ДНК. Наконец, мы знаем, что экстремальный секс - его болевая точка.
  - В смысле? Я же сказал тебе, что в "Hot Hot Spot" был не он. Могу доказать: у меня есть ДНК того, кто там был.
  - Возможно, возможно... Но даже если и так - тот, кто это устроил, много знал о Купере. Детство в криминальном районе, модицифированная внешность. Он проходил по делу о жестоком обращении с ребенком, ты в курсе?
  - Купер? Я только сегодня смотрел базу, его там вообще нет.
  - Серж, ты не там смотрел. Он был жертвой. Единичный эпизод, и до изнасилования вроде не дошло, только незначительные травмы и унижение, но... почитай, что пишут психологи. У многих жертв рано или поздно возникает идея попробовать другую роль. Да, и еще вишенка на торт: ты знаешь, что за курс слушал в универе убитый?
  По всему было видно, что детективу Джеймсу Уильямсу не терпится арестовать человека из десятки самых влиятельных и он уже готовится к пресс-конференции.
  - Но ты понимаешь, что это может быть и подстава?
  - Я рассматриваю все версии.
  Ага. Подстава тебя тоже устроит, но расстаться с мечтой о том, что убийцей в твоем расследовании может быть Стенли Купер, ты так просто не готов.
  
  
  Лестничную площадку уже перечеркнула алая полоска лазерного луча, рядом стоял полицейский при оружии, с устройством считывания идентификаторов. Второй дежурил у подъезда. На постороннего тот и другой посмотрели недобро.
  ...Значит, Стив или Стенли приходит в эту квартиру - шикарную для Стива и нищенскую дыру для Стенли. Приходит как к себе домой, с хозяйским ключом и рюкзаком за спиной, заявив девушке и родне, что начинает новую жизнь именно по этому адресу. Убивает хозяина в порыве противоестественной страсти либо находит труп, выбегает весь дрожащий... Нет, все же это Стив. Иначе перебор с совпадениями: Стив назвал девушке адрес, а пошел по нему Стенли. И тогда вырисовывается схема подставы. Крупная пакость для Стенли, а Стива просто сыграли втемную. Стив, пожалуй, не убийца: если бы ему поручили убить, он не вел бы себя так глупо, а если убийство незапланированное - откуда следы, ведущие к Стенли? Его дело было - зайти в квартиру, засветиться перед видеокамерами, как ночью в клубе - перед камерами репортеров. А потом... Парень из Аллеи Славы, найдя труп в квартире, которую считает своей, побежит не в полицию, а от полиции, это ясно. То есть доиграет роль до конца. Мог ли он отправиться к Адамсу и потребовать объяснений: "во что вы меня втянули" и так далее? Если идиот, то мог, и тогда, возможно, его уже не найти.
  Но гарнитура? Вот гадство, гарнитура все портит.
  Чтобы осмотреть дом с другой стороны, надо было зайти с Рочестер-стрит - здесь была блочная застройка, дома смыкались боковыми стенами. Если все-таки принять версию с подставой, то остается непонятным, откуда взялся настоящий убийца и куда делся потом. Два Гарри Поттера и человек-невидимка.
  Что делает профессионал, чтобы избежать видеокамер? Вырубает камеру импульсом. Надевает маску или прикрывает лицо любым другим способом. Входит с ключом от другой квартиры. Но если гость открыл дверь в подъезд и не вошел в квартиру, то полицейский софт помечает такой вход как подозрительный, Уильямс этого не пропустил бы. Выбирает время проходов так, чтобы оказаться вне подозрений... но когда я вошел в квартиру, убийцы там не было, это точно. Одежный шкаф не так велик, чтобы поместился человек. А если и поместился, значит, его возьмут сейчас, но что-то слабо верится.
  На той стороне между домом и Двадцать четвертой был небольшой сквер. Полдюжины юношей и девушек сидели и лежали на газонах под радужными зонтиками солнечных батарей, уставясь на экраны вифонов и компов - пытались скопировать информацию из машинной памяти в органическую или просто тупили в Сети. Подъездов на задней стороне дома не было, не видно было и камер. Зато имелись балконы. Широкие, от стены к стене, попарно смыкающиеся. Перелезть ничего не стоит, и даже спуститься с этажа на этаж вполне реально. И тот, кто это проделал, мог пройти мимо других камер, установленных в соседнем подъезде. Записями с которых, полицейские, скорее всего, не заинтересуются. И лазанье по балконам с улицы некому увидеть, особенно ранним утром, к тому же третий этаж заслонен кронами деревьев...
  ...Сквозняк, когда я влезал в квартиру. Слабый ветерок, но такое бывает, только когда квартира продувается насквозь, с теневой стороны на солнечную. Он не до конца закрыл дверь либо оконную раму, когда уходил. Не смог, а может, торопился.
  Сергей вытащил вифон и набрал Уильямсу записку: "Пошли ботов на балкон". Юный Джим, хоть и дурак, но умный, пренебрегать советом не станет.
  
  ***
  
  Пора было, однако, перекусить. Сергей заказал ланч в кафе и съел салат с бифштексом, не доставая вифона: имеет он право спокойно пообедать? За кофе уже открыл экран и немедленно увидел два вызова от клиентки. Во второй раз она даже пообщалась с его инфом, разъясняя, как срочно ей нужен детектив Островски. А что ж, и в самом деле есть о чем поговорить.
  - Мистер Островски? О, как я рада, что вы позвонили! Это было потрясающе! Как же мне повезло, что я обратилась именно к вам! Мне сказали, что вы были на месте убийства раньше полиции, как вам это удалось?
  Искреннее восхищение, не отмоделированное согласно требованиям этикета. Серые глаза сверкают, кулачки прижаты один к другому под подбородком - девчоночий жест восторга.
  - Миссис Лайон, мне это удалось очень просто: я искал человека, за которым вы поручили мне следить, а нашел труп. Чтоб быть точным, я и вызвал полицию. Откуда вы знаете про убийство?
  - О, я никак не думала... - девочка приняла виноватый вид, однако холодный тон ее не особенно обескуражил. - Я не предполагала...
  - Вы не предполагали - что именно?.. Миссис Лайон, вам не кажется, что мое личное впечатление уже успело сформироваться? Может быть, поговорим начистоту? Что вы знаете об Уилларде Адамсе?
  - Ох, ну ладно. Я просто очень беспокоилась о Стенли... о докторе Стенли Купере. Мы давно знакомы, в какой-то момент я поняла, что против него что-то затевают и что это Адамс... Ничего больше я не знала, все остальное о нем рассказали мне вы. Мистер Островски, вы не будете возражать, если я передам вас его адвокату?
  - Чьему адвокату?
  - Доктора Купера. С ним уже связались из полиции и запросили доступ к геному!
  Ну естественно.
  - Подождите, миссис Лайон, еще один вопрос. Как хорошая знакомая Стенли Купера, возможно, вы видели у него этот предмет? - Сергей сунул в окно фотографию с сайта "Айю".
  - Господи, - она усмехнулась, - конечно, видела. Трудно было не заметить, он страшно им гордится. Эта затычка в ухо стоит как бриллиантовая серьга. Знаете, есть такие мужчины - носят трехдолларовые майки, питаются чипсами, но по гаджетам с ума сходят, готовы отдать любые деньги.
  - С этой гарнитурой не было никаких происшествий? Он не терял ее, например?
  - Насколько я знаю, нет. Скорее он свою голову потеряет! Но обязательно спрошу у него. Так я передаю вас мистеру Хаксли?
  Что-то было необычное в ее тоне, когда она говорила о Купере и о его гаджете. Нет, не любовница. Так тепло и насмешливо говорят о любимых братьях, о тех, с кем долго работаешь плечом к плечу. Но не могли же работать вместе IT-магнат и богатая женщина из небольшой телекомпании? Или могли?..
  В новом окне возник адвокат, идеально причесанный блондин в идеальном костюме (причем Сергею показалось, что это был реал, а не переговорный аватар). Сергей в третий раз за последние сутки изложил историю слежки за Адамсом, потом перешел к поиску Стива и трупу на Двадцать второй. Адвоката обрадовало известие про анализ ДНК с сигареты. Кулаком о кулак он не стучал, но заметно просветлел.
  - Теперь скажите мне, мистер Островски: а тот, м-м, биоматериал, что был на месте преступления, - вам не пришло в голову взять образцы?
  - Пришло. Это не запрещено, если не мешает работе полицейских экспертов. Я взял мазок, на полногеномное секвенирование должно хватить.
  - Вы считаете, это в интересах моего клиента?
  - Я считаю, что результат секвенирования вашего клиента должен угробить. Образец наверняка фальшивый, тот, кто обеспечил остальные улики, уж конечно, подумал и о том, чтобы ДНК в биоматериале, похожем на сперму, была какая надо. А вот о чем они могли не подумать - что кто-то сразу спросит, не фальшивка ли это. Обнаружить фальсификацию можно, но это уже анализ белков, довольно дорогое удовольствие...
  - Я понял вас, мистер Островски. Вы можете взять на себя труд заказать анализы, какие считаете нужными? Счета пусть адресуют мне. Разумеется, и ваше вознаграждение в подобающем размере...
  Сергей заверил, что он все устроит, и анализ, и встречу с консультантом, который подсказал бы, где могли провести полногеномный синтез ДНК в количествах, потребных для фальсификации: дело возможное, но не самое простое. Ну вот и YPLab не забыли, заказы с пожеланием "сделать все анализы, какие считаете нужными" у них бывают не каждый день...
  - И теперь самое главное, мистер Островски. Миссис Лайон в восторге от вашей работы, и я склонен разделить ее оценку. Не согласитесь ли вы теперь поработать на моего клиента? Как вы понимаете, мы очень заинтересованы в том, чтобы найти Стивена Грейвза. Нам необходим свидетель. Его ищут полицейские, но, как мне представляется, параллельное расследование будет не лишним.
  - Он наверняка залег на дно.
  - Мистер Островски, будьте уверены, мы осознаем все трудности. Однако дело идет о репутации человека, в конечном итоге, возможно, о благополучии всей компании, тысяч людей. Полагаю, будет справедливо, если мы поднимем ваши обычные расценки на порядок. Разумеется, я говорю как о повременной оплате, так и о премии за результат, в том случае, если он будет достигнут.
  - Конечно, я попытаюсь. Но ведь есть еще Уиллард Адамс?
  - Я уже выяснял. Следствию будет трудно найти к нему подход. По его утверждению, он возил молодого человека в клуб, чтобы посмотреть шоу и выпить. Он не скрывает своего интереса к досугу определенной направленности, но утверждает, что всегда ограничивался наблюдением. Опять же по его словам, Стивен участия в шоу не принимал.
  - А как насчет алиби у вашего клиента?
  - Увы. Он находился дома, спал, работал. Это подтверждает домовая компьютерная система, но, как вы, вероятно, догадываетесь, это не слишком веское доказательство, особенно с учетом профессиональных характеристик моего нанимателя. И последнее, мистер Островски: мой клиент крайне заинтересован в том, чтобы все было сделано как можно быстрее. Вы ведь знаете: пока правда сапоги надевает... Компрометирующую информацию легче распространить, чем опровергнуть. Вы меня понимаете?
  Чего тут не понимать: нельзя допустить и предъявления обвинения, которое наверняка попадет в новости. Как бы чисто ни отмыли человека потом, как бы убедительно ни доказали невиновность, - "был подозреваем в убийстве на сексуальной почве" из новостей проникнет в энциклопедии и сетевые биографии, и вступит в силу эта прекрасная формулировка - "но ведь так или иначе что-то было". И запах дерьма навсегда останется с тобой, сколько ни заплати.
  
  ***
  
  ...Итак, Стивен Грейвз, молодой человек из Аллеи Славы, служащий кафе на автозаправке и гарепотер. Оптимистично предположим, что Стив не покойник. Не убился по пьяни или от усталости, не прыгнул с моста в реку, огорченный внезапным поворотом судьбы, и Адамс его не прикончил. В таком случае где он может скрываться? У друзей... друзей, отец сказал, нет, хотя это стоило бы проверить. У девушки? Девушку наверняка уже трясут полицейские, и, в общем, это был бы не самый умный ход. Убил и закопал еще какого-нибудь из своих двойников, кроме Плохого Гарри, и занял его место? Попытался уехать из города? Если попытался, его опять же возьмут и без меня, во всех транспортных узлах и видеокамер, и полицейских хватает. Разве что на попутных машинах, если Адамс расплачивался с ним деньгами. А вот если обещанной платой была квартира на Двадцать второй, тогда парень еще и без денег.
  Но неужели в городе нет таких мест, где можно переночевать и где никто не задает лишних вопросов? Где-нибудь в благотворительных ночлежках. И есть же места, где нанимают дешевую рабочую силу, включая нелегалов... Островски, ты тормоз!
  Уильямс на вызов отозвался не сразу. Голос у него был недовольный.
  - Серж?.. Да, ты был прав, кто-то влез с балкона. Спасибо тебе большое. Нет, не нашли пока твоего Стивена Грейвза. Вокзалы, аэропорты, уличные камеры - по нулям. Дома не появлялся, у подруги тоже... Куда съездить? Почему?.. Слушай, я не могу, я еще оформляю осмотр. Если хочешь, отправлю кого-нибудь из ребят. Ты сам поедешь? Ну ладно.
  
  
  Через полчаса Сергей припарковался около плоского здания, похожего на стопку картонных папок, украшенную зеленым логотипом "Доктора Спринга". Это была одна из трех фабрик в городе - единственная, где менеджер по кадрам подтвердил, что к ним сегодня нанялся белый моложе тридцати. "Двадцать один год. Как выглядел? Обычно выглядел, я не приглядывался". Обычно... Но проверить все-таки надо. Зовут его, со слов того же менеджера, не Стивеном Грейвзом, однако плох тот безработный, который не может временно нарисовать себе другое имя, сославшись на поломку идентификатора.
  Место, о котором Стив знал и даже говорил, место, непрестижное даже для обитателей Аллеи Славы. Место, где не слишком придираются к документам и рекомендациям, где наемная рабочая сила спит в капсулах, а на работе заставляют носить просторные стерильные комбинезоны и маски. Идеально для парня с запоминающейся внешностью, который бежит от обвинения в убийстве.
  Но гарнитура? Где-то я уже видел ее, и еще до того, как скачал фотографии из клуба. Точно такую же, маленькую, с изогнутой антеннкой. Не приснилась же она мне.
  Наконец подъехала полицейская машина, из нее вылезли двое парней, огляделись. Сергей помахал им. Копы оказались нормальные, дружелюбные. Вместе пошли к служебному входу - менеджер скинул ему видео со стрелочкой, указующей путь.
  Их встречали трое, один - тот самый менеджер, другой оказался начальником смены, третий - каким-то заместителем начальства с длинной надписью на бэдже.
  - Добрый вечер, здравствуйте, офицеры. Нам придется пройти к чистым цехам, наш новенький уже заступил на смену, я ему пока ничего не говорил, как вы и просили. Никогда бы не подумал, совершенно адекватный человек, и все анализы идеальные, никаких инфекций... Сюда, пожалуйста.
  Минималистически обставленная комната отдыха. Экран с "нашими успешными сотрудниками", объявления о выговорах и поздравления с карьерным ростом. Еще один поворот, и прозрачная стена, за которой виден чистый цех. На вид действительно очень чистый, все белое, бирюзово-зеленое и стальное, - документальный фильм про Арктику с отключенным звуком. За стеклом расхаживали фигуры в белых комбинезонах, таких же беретиках, похожих на гостиничные шапочки для душа, и в масках с очками. Основным объектом их деятельности были подносы с овальными гнездами знакомого размера: в каждом предстояло вырасти гамбургеру. Одни везли на тележках стопки этих подносов, другие разливали дозаторами по гнездам прозрачную алую жидкость, третьи подсоединяли к подносам какие-то приборы и надвигали герметичные крышки. Начальник смены надавил кнопку, дверь шлюза с шипением убралась в сторону. Через полминуты он появился внутри и пошел по цеху, разглядывая номера на комбинезонах.
  Новенький работал по подтаскиванию и оттаскиванию. Когда его окликнули, начал слезать с тележки, но, получив указание, залез обратно и отогнал ее к дальней стене. Вернулся. Стеклянная стена, очевидно, была прозрачной только в одну сторону - на встречающих его взгляд не задержался.
  Наконец они вышли в коридор. Человек в комбинезоне увидел начальство и двух полицейских.
  - Снимите, пожалуйста, маску.
  Рука, обтянутая перчаткой, стащила маску на грудь. Десятикратное вознаграждение, подумал Сергей Островски. В следующую секунду Стив метнулся в сторону и побежал прочь по коридору.
  - Стоять!
  Ага, как же. На повороте поскользнулся в тряпичных тапочках, едва не упал, но удержался на ногах. Полицейские бежали за ним, уже поднимая нейростволы.
  - Да стой же, дубина! - заорал Сергей. - Мы знаем, что тебя подставили, ты свидетель!
  
  ***
  
  Парни категорически возражали, чтобы свидетель, уже пытавшийся бежать, ехал с частным детективом. Пришлось Сергею отправить свою машинку домой с автопилотом, а самому пересесть к ним. Удалось Стиву поспать в капсуле или нет, но вид у него был скверный - лицо бледное, как пластик, зеленые глаза обведены тенью. Юный Гарри после финальный битвы с Вольдемортом. Сходство усугублялось тем, что бороду он сбрил.
  - Я нашел работу. Откладывал на учебу, была у меня такая надежда. Он заходил в кафе каждый день и все присматривался ко мне. На меня часто смотрят, вы понимаете почему. Ненавижу это. Я ему нахамил - ну как, в пределах, за что еще не сильно штрафуют, не назвал бонусов и зубочистку не положил. Он не обиделся вообще, жаловаться не стал. Сказал, что у него для меня есть работа, угостил пивом - не у нас, конечно, у нас пива не подают. Спросил, как жизнь, какие перспективы. И потом говорит: я, мол, квартирный агент, я мог бы снять тебе жилье на год вперед, все оплатить и сделать так, что на кредитную историю никто и не взглянет. Но за это ты должен съездить в один клуб и поучаствовать в шоу. Не бойся, говорит, ничего страшного с тобой не сделают, но потерпеть придется, фикшн-сексуалы - люди с фантазией... Я хотел ему дать в зуб, но потом, в общем, согласился.
  - За аренду квартиры?
  - Мистер Островски, вы же видели дом, где я живу? Думаете, можно учиться, когда там живешь? Даже если я накоплю денег, я ни один тест не сдам. Летом жарко, как в аду, зимой холодно. Дети все время орут, телевизор все время включен. И то им за водой сходи, то за едой. Седьмой без лифта, не папа же пойдет. А еще эта моя гребаная рожа, если на лестницу выйти учиться - еще хуже будет... Знаете что, полчаса в наручниках и один-другой шрам - это фигня по сравнению кое с чем другим.
  - Понимаю.
  - Что вы нахрен понимаете. В общем, я только сказал, что не хочу, чтобы мои фотки были в Сети. А он сказал, что клуб строго закрытый, даже в дип-веб ничего не утечет. Велел своего имени нигде не называть, а сам называл меня Стенли, когда мы там были.
  - А та штука, что была у тебя в ухе? - Сергей показал пальцем изгиб антенны. - Зачем он тебе ее дал?
  - Сказал, переговорное устройство для крайних случаев, типа, он мне передаст, что пора смываться, если что-то пойдет не так. Только, по-моему, оно не работало. Таких нет вообще на самом деле. В сайфай такие есть, которую по четвертому каналу крутят, ну вы знаете, про ботана-мутанта, который захватил все компьютеры в Пентагоне и хочет устроить мировую войну. Вот, может, он в фанатском магазине купил. Не знаю зачем, кто их заморочки поймет, они же уроды.
  Сергей мысленно выругался. "Последний пароль", производство ATV, я же просмотрел целую серию этой ахинеи, когда начинал следить за Адамсом! Точно такие перламутровые горошины с усиками были у всех троих тамошних мутанов-ботантов. Это в реале, Джим, их только двадцать, а в кино - да сколько хочешь! Тонкий продактс-плейсмент, копии новейшего гаджета в подростковой фантастике. Не помню, имел ли отношение Адамс к этому сериалу, но в любом случае добыть элемент реквизита куда проще, нежели настоящую игрушку от "Айю".
  - А сейчас она у тебя?
  - Не, я ее выбросил. Она на биоклее держалась, только днем оторвалась. А в первые разы он мне вообще ее не давал.
  - Сколько раз вы ездили в клуб?
  - Три раза. А перед этим позвал меня к себе на работу, в агентство "Саут-Риэлт", показал квартиру в вирте, ввел мою биометрию в договор, сказал, что ключ и карту хозяина отдаст после третьего раза.
  - Ты знал, как снимают жилье? Что для этого нужно, и все такое?
  - Ну, видел в фильмах, а что? Намекаете, что он меня кинул?
  Намекаю, парень. Ты вошел в вестибюль, тебя встретил твой знакомый, одетый приблизительно так, как одеваются тамошние сотрудники, - а мелкие несоответствия ты едва ли мог заметить от волнения, небось, впервые в жизни попал в такое важное место, где тусуются богатые трудоустроенные. Задрипанная, в сущности, контора, но все в мире относительно. Для настоящих сотрудников это выглядело так, будто двое посетителей договорились о встрече и выбирают квартиру в комфортных условиях, дозревают до заключения договора. А уж куда он ввел твою биометрию и какие еще изобразил внушительные действия из тех, что показывают в фильмах студии ATV - про то знает он один... Цинизм и эффективность. Тебя купили за стоимость обращения к базе квартирного агентства.
  - Да я и сам понял. Когда вошел и увидел - чужие вещи, а потом этот... - Стива передернуло. - Спасибо вам, мистер Островски. Жалко, конечно, остался я при своих. Но ничего, выкарабкаемся. Домой не поеду, ну их нафиг. Месяц поработаю по договору, а там видно будет. Я сейчас смотрел почту - сестра записку бросила, что мне какие-то выплаты полагаются, а я и не знал.
  
  ***
  
  - Но это ужасно, - сказала Беатрис. - Я поговорю со Стенли, пусть он ему поможет. Для него это смешные деньги, а для мальчика вопрос жизни и смерти. В конце концов, они ведь в каком-то смысле не чужие друг другу, вы согласны?
  - Я тоже хотел бы поучаствовать, - ответил Сергей. Нехорошо получилось с "выплатами". Стиву он так и не признался, но уши начинали гореть, когда он об этом вспоминал. - Ладно, главное, что обвинения ему не предъявят.
  Они сидели на веранде летнего кафе. Теперь, когда дело сделано, можно побеседовать в неофициальной обстановке. Беатрис опять была в летнем брючном костюме - на этот раз серовато-стального цвета, вместо пиджака френч с застежками через грудь и высоким воротом. Розовый июньский пион в серебряной бумаге. Сергей никогда не флиртовал с клиентками, даже по окончании работы. Это было бы непрофессионально... совсем непрофессионально.
  - А убийцу нашли?
  - Нашли. Посмотрели, кто арендовал смежную квартиру, проверили видеозапись, личность оказалась известная, засветился еще и в клубе, когда передавал Адамсу хозяйский ключ. Он не очень-то и отпирался, как я понял. Нанимателя сдал сразу же. Есть русская поговорка: раньше сядешь, раньше выйдешь.
  Беатрис поговорке не улыбнулась.
  - Как им удалось снять квартиру рядом с жертвой?
  - Все было наоборот. Адамс снял квартиру, которая была свободна, а жертвой стал тот, кто арендовал соседнюю. Мог быть любой человек. А то, что он посещал курс лекций, который читал Купер, это так... вишенка на торте, как выразился мой коллега.
  Беатрис поежилась, обхватила себя за локти.
  - Ни за что бы не подумала, что Уиллард... Он всегда был такой... позитивный.
  - Вы мне так и не сказали, что он не поделил с Купером. Или это закрытая информация?
  - Серж, после того, что вы уже узнали... - Беатрис очаровательно улыбнулась. - Уиллард хотел, чтобы его шоу взяли в один из проектов Хеликса. Там совершенно другой охват аудитории, другие рейтинги. А Стенли его зарезал. Как мне передавали, говорил очень жестко, употреблял выражения вроде "этой тупой хрени у нас не будет, пока я занимаю свое место". Стенли умеет убеждать, у него есть это свойство. Его мнения заразны, как зимний грипп, если вы понимаете. И Дейв, наш директор, сказал Уилларду: или ты доводишь свой кукольный театр до ума и делаешь вторую попытку, или ищи другую работу.
  - Кукольный театр?
  - О, это самое смешное!.. Вас не шокирует, что я смеюсь, когда погиб человек и все такое? Нет? Просто и вправду очень смешно, хотя и печально, конечно. Это шоу Уилларда называется "Быть звездой", участники получают аватары известных актеров и должны действовать во всяких бытовых ситуациях, - узнавание на улице, безумные поклонники, журналисты... да, вот представьте себе! Я намекала Уиллу, что он идиот, что в Хеликс нельзя с этим соваться, было же ясно, что Стенли уложит его в гроб и забьет гвоздями! Но он и вправду идиот. Еще больший идиот, чем я думала.
  - Вы давно знакомы с Купером?
  - Давно? - Беатрис нахмурила брови. - Двадцать пять... или двадцать шесть лет? Мы росли вместе, наши матери были подругами. И у нас была общая проблема. Вы ведь уже догадались, правда?
  - Как? Вы тоже?..
  - Тоже модифицированная внешность. Но я старше Стенли, когда меня отдали в начальную школу, он был еще совсем крошечным. Я играла с ним как с куклой. Звала его маленьким Гарри, рисовала шрамик на лбу фломастером, придумывала сказки про него в Хогвартсе - ну, вроде фанфиков, он всегда побеждал всех врагов. И дралась с теми, кто его обижал. Мне-то самой было легче, мой прототип хотя бы в детстве не прославился.
  Она выжидающе, с кокетливой улыбкой взглянула на него.
  - Беатрис, я сдаюсь. Не могу узнать.
  - На самом деле теперь никто не узнаёт. Я постаралась, чтобы не узнавали. Но вы же сыщик, Серж! Посмотрите внимательнее. Мне и фигуру делали, в моем случае это было важно, - десять лет назад все параметры совпадали до полудюйма!
  Сергей посмотрел внимательнее, как учили в полицейской академии. Минус современный макияж и костюм, минус выражение лица, только само лицо. Грубоватый овал, толстый нос, коротко подстриженные каштановые волосы искрятся, как спинка жука, - так бывает у очень юных девушек. Кроме волос, красивы разве что серо-голубые глаза под пшеничными бровями и полные губы. Рост небольшой, не звездный, и объемы великоваты.
  - Извините, я не знаток кинематографа.
  - Тут не надо быть знатоком. Ее звали Норма Джин Бейкер.
  Простите, не помню, чуть не сказал Сергей, и тут до него дошло. Беатрис рассмеялась.
  - Мэрилин?!
  - Могу надеть юбку и постоять над вентилятором, - предложила она.
  - Но... э-э....
  - У нее были осветленные волосы, другие зубы. Те генетики могли бы заодно сделать меня и блондинкой, но тогда бы изменился оттенок кожи. И, конечно, мимика. - Она подалась вперед, навалившись грудью на край стола, запрокинула голову, ослепительно улыбнулась, прищурив глаза и приложив указательный пальчик к щеке; на мгновение он увидел, но улыбка тут же сменилась насмешливой гримаской. - Мамочка заставляла меня часами тренироваться перед зеркалом и ее фотографией. Красная помада, ресницы. А что делали женщины двадцатого века со своими бровями, вы не поверите, если скажу, - настоящая китайская пытка!
  - И ваша мама была права? Вы добились успеха?.. Ох, извините.
  - Ничего. - Отключив Мэрилин-режим, Беатрис переменилась поразительно - как погашенная лампа-витраж. Или зажженная. Сергей сейчас не мог бы сказать, какая Беатрис ему нравится больше: то мгновенное видение, еще одна копия знаменитой фотографии - или эта женщина с ее грустной усмешкой.
  - Ничего страшного. Я даже хотела бы вам рассказать. Вы ведь не выдаете тайны клиентов, правда? Возможно, я единственная девчонка из Аллеи Славы, с которой случилось чудо. Я встретила Ника, моего будущего мужа, на фанатском форуме. Искала там фактуру, а он был одним из главных знатоков. В первый же день он меня отчитал за наглость и пошлость - как я посмела взять вместо аватара Ее видеореконструкцию! Не хотел верить, что я в самом деле так выгляжу. Потом мы встретились в реале. Нику было шестьдесят, я заканчивала школу. Дальше можете догадаться.
  - Это с ним случилось чудо, - подумав, сказал Сергей. Беатрис молча наклонила голову:
  - Может быть. Надеюсь, что он был счастлив. Мы оба были счастливы, на такой странный манер. Для меня была чудом обычная нормальная жизнь. Но наш брак - это было, ну, как бродить по дому в темноте. И нет ничего страшного, и все же так страшно. Ник иногда проговаривался... он и вправду поверил, или внушил себе, что я - это она. Мистическим образом то ли вышла из фильма, то ли воскресла из мертвых и теперь живу с ним. Я могла скандалить, устраивать дикие выходки, как она в ее плохие дни, он только был ко мне еще нежнее. А когда я вела себя хорошо, ему не нравилось. Я сама уже не понимала, кто я и чего хочу. Есть ли я там, внутри нее... Не знаю, что было бы со мной дальше, если бы Ник был жив. Я ведь его никогда не бросила бы. Но коптер упал, никого не спасли. И знаете, что я сделала после похорон? Обрила голову. Мамочка орала, что я чокнулась, а я просто хотела увидеть, какие у меня волосы. Какого они цвета, когда не выбелены. У меня остались те фотографии - я там смешная, на голове щетинка и глаза гипножабы. Вот такие большие и упоротые.
  А теперь она стала похожа на девочку из сквота, вроде Мэгги. И заговорила иначе, даже произношение изменилось. Сергей молча вытащил на стол меню и указал пальцем на алкогольные напитки, Беатрис выбрала рюмку бренди, Сергей умножил на два. Обычно он не предлагал женщинам выпивку, да еще днем, считал это пошлым поведением. Но так само получилось.
  - А что было потом?
  - Ну, у меня ведь был сертификат школы продюсеров - Ник мне разрешил, оплатил обучение, он находил, что это в образе. Пришлось немного подучиться. Теперь уже Стенли мне помог. Ведь я однажды... об этом я еще совсем никому не говорила... да, спасибо.
  - За вас, Беатрис.
  Она проглотила спиртное, как девочка из сквота, без намека на гламур и хороший тон. Или как Мэрилин в роли Душечки, той красотки, что носила фляжку за подвязкой.
  - На четвертом году нашего брака я сказала Нику, что уронила кольцо в раковину. Такое красивое было, с большим изумрудом и каемочкой из бриллиантов. Рыдала, просила прощения, бросалась ничком на кровать, пила мартини из горлышка - уйдите все, не хочу другое, а хочу то... Кольца, конечно, не нашли, Ник купил мне другое и, по-моему, был в полном восторге. А мне было безумно стыдно, больше я никогда так не делала. Но я не могла напрямую попросить у него денег для Стенли. Это только для меня он был младший братик, а Ник увидел бы чужого парня из моего сомнительного прошлого, понимаете? Стенли проучился год в нашем университете, потом получил стипендию Кавы и уехал в Калтех. Вот такая у нас с ним история.
  - А как вы на самом деле узнали, что Адамс что-то замышляет?
  - Что значит "на самом деле"? Я действительно видела его из окна. Но перед этим слышала, как он говорит, что Купер еще пожалеет о своих словах, и что у него, Уилла, есть такие возможности, о которых никто не знает. Я подумала, что он блефует. Все бы так подумали - кто может, тот не говорит. А потом увидела, как он переодевается. Я ничего не понимала и обратилась к вам. (Улыбкой она подчеркнула цитату с сайта детектива Островски.) Я же не могла позволить ему обидеть моего братика.
  Допивая, они говорили о пустяках. На прощание Беатрис подняла брови и сделала губы сердечком, а потом приложила к ним палец.
  ...Казалось бы, работая в шоу-бизнесе, нелогично отказываться от этого сходства? Очевидное и неправильное решение, Островски. Гораздо эффективнее включать его изредка, на мгновение, слабой вспышкой. Никто не останется равнодушным - и никто не поймет, почему так важно то, что говорит эта женщина. Словно весь золотой век Голливуда стоит за ее спиной.
  Сергей сидел за столиком, качая в пальцах рюмку, и смотрел, как она уходит по дорожке, ведущей к парковке, как ступают туфли-лодочки по разноцветным плиткам, как соскользнул с ее спины кружевной полог древесной тени. В динамиках Элла Фитцджеральд пела про апрель в Париже, каштаны в цвету, и все это ужасно напоминало какое-то старое кино.
  
  
  
  На самой обыкновенной улице
  
  До чего же прекрасен город, жители которого говорят на непонятном языке. При условии, что ты сможешь объясниться с ними по-английски, когда проголодаешься.
  Бредешь долгим летним вечером по улице, ведущей к набережной, - тут все улицы ведут к набережной, еще одна примета идеального города. Слушаешь обрывки разговоров: смеющийся глуховатый тенор, недовольное девичье контральто, детский голосок что-то объясняет и требует внимания. А слов не понимаешь. Может, тот блондин рассказывает пошлый анекдот, но я могу вообразить, что он описывает приятелю впечатления от спектакля. Или реконструкцию корабля викингов, с головой морского змея на форштевне и парусом вооот такой ширины...
  Свистнул вифон. Официальное уведомление на шведском и английском: категорически запрещается летать над городом на джет-белте, уникоптере и... в общем, на любом индивидуальном летательном средстве, за нарушение штрафы. Уже второе уведомление. Нет, то было от районной управы, а это от муниципалитета. То ли европейцы перестраховщики, то ли американцев они считают недоумками. Кому придет в голову стартовать на джет-белте с городской улицы?! На островах буду летать, над морем. Уже не рад, что арендовал эту штуку, теперь местный Большой Брат замучает напоминаниями о том, чего нельзя делать. Ладно, забыли.
  ...Вечерний Стокгольм похож на сон - еще и потому, что малолюден в пору отпусков; снящийся город всегда пустоват. И подобно сновидению, составлен из разных эпизодов, не замечаешь, как попадаешь из одного в другой. Старые кварталы - декорации к фильму о Тридцатилетней войне: бюргерские дома под черепичными крышами, в просвете между домами море и мачты, вот-вот в окошке мелькнет белый чепец, и белая рука закроет ставню... А потом набережная: глиссеры на воде, коптеры в небе, спортивные велосипеды и странные суперэкологичные машины - фантастическая утопия, город будущего. Среда обитания красива и ухожена, все заняты трудами на благо общества, дети играют на безопасных улицах. Вон две маленькие девочки прыгают со ступеньки, кто дальше - у одной розовая мордочка и волосы такие белые, как бывает облако возле солнца, другая черноволосая, кудрявая и темнокожая. А платья одинаковые.
  Бредешь между городом и морем, засунув большие пальцы в карманы брюк и бездумно глазея по сторонам. Море дышит влагой и водорослями, город - камнем, кофе и корицей. Свежий ветер - теплая кофейная волна - опять ветер; полоса за полосой. Шведы сами не свои до кофе, его горячие источники бьют буквально через каждые сто метров, не летнее кафе, так автомат. Зачем летать, слушай? И на земле хорошо.
  Собственно, это не море, а пролив, здесь полно проливов. Или как там их... шхеры, фьорды - никогда не мог запомнить, что из них земля, а что вода. Здесь воды едва ли не столько же, сколько земли, и в городе поэтому светло и просторно. Как будто упрямые скандинавские инженеры прокопали где-то перешеек горизонта, и вечернее небо само разлилось по каналам.
  
  ***
  
  Сергей Островски приехал в Европу на тренинг по розыскным мероприятиям в Сети. Бесплатно, как победитель международного виртуального шоу детективов. Один из победителей от Соединенных Штатов, но мог бы быть и самым первым. Все было серьезно. Сюжеты и локации взяты с реала, и не все дела - как и в жизни - имели зацепку, некоторые раскрыть было нельзя, причем игроки не знали, какие именно.
  Своего аватара он на всякий случай сделал рыжим и конопатым. Не хватало только, чтобы знакомые, посмотрев шоу, узнали, какой ерундой занимается Островски. Рыжий аватар публике понравился, Сергей даже получил пару предложений от ай-студий. Во второй раз спросил о возможных размерах оплаты. Убедился, что расследование вымышленных дел оплачивается дороже, чем настоящих, и с глубокой признательностью отказался. Только на вручении призов он узнал, что одно из раскрытых им преступлений было задумано как нераскрываемое. За это ему и снизили балл: некоторые арбитры не поверили, что он играл честно.
  Конкурс организовала Всемирная ассоциация детективов, а в Стокгольме сидел информационный партнер - создатели виртуального шоу, они же устраивали тренинг. Сергей рассудил, что ничего нового о сетевом поиске шведы ему не расскажут, но почему бы и не пожить за счет приглашающей стороны в красивом европейском городе.
  С первым пунктом он ошибся - тренинг получился плодотворным. Да и со вторым вышло как-то не совсем так. Уже на третий день Сергей понял, что уезжать в воскресенье вечером ему не хочется, а хочется гулять по городу. А еще полазить бы по гранитным скалам на островках, полетать над этой красотой (зря, что ли, сдавал тесты и столько денег угрохал?), поесть лосося, который был здесь невероятно дешев и по-шведски назывался угрожающе - "лакс"... И как на заказ, разговорились во время кофе-брейка с коллегой.
  Оскар Юландер бегло говорил на американском английском, а выглядел как типичный швед, какими их показывают в кино. Светлые патлы, худое острое лицо, серо-голубые глаза - вылитый третий сын крестьянина, победитель троллей и счастливый супруг золотоволосой королевны. На самом деле тролли Оскара интересовали постольку-поскольку. Он работал аналитиком в агентстве по чрезвычайным ситуациям, и его специальностью были социальные сети и медицина.
  - Ты исследуешь сообщества, где собираются врачи?
  - Как раз наоборот, - Оскар подмигнул ему. - Моя тема - непрофессионалы, говорящие о медицине. Знаешь Флю-Трендз?
  - Мне стыдно, но нет.
  - Это, ну... вот если человек простудился, он, скорее всего, не обратится к врачу с таким пустяком. А что он сделает? Он наберет в поисковике "лучшие капли от соплей". Или напишет в блоге: братики и сестрички, черт побери, у меня течет из носа, на виллу не едем, и спросит, чем полечиться.
  - Советы от друзей не всегда бывают полезными, - заметил Сергей.
  - А, это не имеет значения. Неважно, что они посоветуют, важно, что спрашивают. Сколько человек и где. Поисковые запросы дают отличную картину эпидемий, ты не знал?
  - Всегда думал, что такую статистику собирают врачи.
  - Врачи тоже, - великодушно согласился Оскар. - Но наша лучше по ряду показателей. То, о чем нам твердили на открытии, - что мы сидим на информационных золотых россыпях и пока добыли только пару крупинок, - это правда.
  - Так ты занимаешься гриппом?
  - И гриппом в том числе, - Оскар сунул в рот остаток булочки с корицей и отхлебнул кофе. - Много есть болезней, тем более сейчас, когда все путешествуют. Всегда есть шанс, что кто-то привезет с обратной стороны мира какую-нибудь чуму или холеру.
  Прозвучало это скорее мечтательно, нежели наоборот.
  - Холеры у меня нет, - признался Сергей. - Американский насморк в следующий раз привезу, честное слово. Надеюсь, еще приеду когда-нибудь.
  - Как тебе Стокгольм?
  - Потрясающе. Остался бы здесь еще на неделю, просто как турист, но не знаю, где поселиться. Посмотрел цены, задумался.
  Оскар отставил стаканчик в сторону.
  - Пойму, если откажешься, но есть один вариант. Конечно, это не вип-апартаменты...
  Оказалось, после конференции он едет в Упсалу как раз на неделю и будет рад уступить свою съемную квартиру на этот срок за четверть месячной оплаты. Оскар, сам заядлый походник, рассказал, куда лучше съездить полазить по скалам и полетать над морем, и как сделать, чтобы меньше доплачивать за страховку. Все формальности разрешились легко и быстро, билет удалось обменять, денег на счету у Сергея хватало, а дома не было таких дел, которые нельзя перенести.
  Почему хорошо не иметь над головой задницу босса - ты сам себя отправляешь в отпуск. Почему плохо - все время забываешь это сделать, и никакой профсоюз не защитит твои права. А отдыхать надо.
  
  ***
  
  Он собирался обойти остров по побережью, но по ошибке забрел на мост, и когда сообразил это, поворачивать не стал. Навигатор подсказал, что впереди и чуть левее находится исторический центр со всяческими приманками для туристов.
  Набережную не отделяли от воды никакие ограды, здесь швартовались кораблики, брали на борт пассажиров и снова отчаливали катера и лодки. Но что сразу привлекало внимание, так это скульптура.
  Глыба розового гранита, издали похожая на гигантский отполированный валун, оказалась парой мифических существ. Существа сидели в обнимку, и Сергей не сразу понял, что у них где и что кому принадлежит. Потом сообразил: у каждого по два хвоста, в отличие от русалок Голливуда. Морская дева по человеческим меркам была вполне симпатичной, морской парень... пожалуй, на любителя, если кому нравятся борцы сумо и брутальные физиономии. Хотя русалка в объятиях могучего русала выглядела счастливой. И он, и она держали свободные руки ковшиком, отвернув в сторону ладонь, скрывая от партнера подарок. У нее оказалась ракушка, у него рыбка - тонкий символизм. Ну а табличка-то с подписью где?
  Табличка сзади, на низком постаменте. Он опустился на колено, поднося вифон к идентификатору, - захотелось узнать про скульптора. Чей-то палец постучал его по плечу, и звонкий голосок задал вопрос.
  За спиной у него стояла сама Швеция. Белоснежные теннисные туфли, голени орехового цвета, светлые джинсы, обрезанные чуть выше коленок, белая майка (Сергей поискал глазами велосипед, но его не было); русые волосы расчесаны на прямой пробор и вьются смешными мелкими кудряшками, будто от расплетенных косичек. И очень хорошенькая, правда. Она снова о чем-то спросила.
  - Простите, я не говорю по-шведски, - ответил Сергей, напирая на американский акцент, и постарался изобразить улыбкой "но если хочешь, начну учиться прямо сейчас". - Чем могу помочь?
  Казалось бы, какую тактическую ошибку можно совершить в двух стереотипных фразах? Улыбка исчезла, милое лицо выражало досаду или даже отвращение.
  - Простите, я приняла вас за другого человека.
  - Я не могу его заменить?
  - Нет, спасибо.
  - Очень жаль. Меня зовут Серж, и я из США. А как ваше имя?
  - Кристин, - серые глаза блеснули стальными зеркальцами. - Пока, Серж.
  Не любит американцев? Стоило заговорить по-русски? И вправду жаль, но ничего не поделаешь. "Пока" прозвучало недвусмысленно, без намека на "может быть", а навязывать свое общество девушке в этом идеальном городе - себе дороже, Оскар и Бертиль предупреждали. Кстати, она такая же Кристин, как я сэр Ланселот, тут не надо быть экспертом по микромимике. Ладно, девушек в городе много, а впереди шесть дней.
  Он двинулся дальше - снова ветер с пролива, запах кофе, две чайки выясняют отношения прямо под ногами у людей... Когда он обернулся, кудрявая Кристин у монумента о чем-то говорила с другой девушкой. Коротко стриженной, в модных разноцветных шальварах, но, несомненно, девушкой.
  Идти на встречу в условленное место, не зная, как выглядит контрагент, - в наше время обычно. Но не знать, какого он пола, все же необычно, так? Или же мне пора сменить прическу. Она ведь подходила со спины и могла... да нет, не могла, не настолько все плохо.
  Сергей поднял вифон и повел им в воздухе, как бы снимая панораму. На самом деле у него были включены максимальное увеличение и программа распознавания лиц. Зачем? Ну, допустим, затем, чтобы всякие девчонки не могли похвастаться, будто ввели в заблуждение призера международного конкурса. Кристин ее зовут, видите ли...
  Девушки поднялись по ступенькам и пошли к мосту. Сергей понял, что ведет их, только когда сам оказался наверху. Без работы жизнь не мила, детектив... У входа в метро они сели в крохотную девичью машинку, шальвары - за руль, Кристин - на пассажирское место. Сергей обошел с наветренной стороны палатку местного фастфуда, где подавали картошку с рыбой, взял из автомата стаканчик кофе, уселся на скамейку и вытащил из вифона клавиатуру.
  
  
  Настоящее имя Кристин было Нора Хейно. Училась она в что-то-там-по-шведски-колледже, постоянно жила в Стокгольме. Чтобы узнать это, Сергею понадобились примерно тридцать секунд. Никаких спецтехнологий, только общедоступные приложения и грамотный поиск в открытых источниках. Социальные сети - великое изобретение. Люди все время рассказывают о себе, хотя им кажется, что они обсуждают фильмы, распродажи и политические события. Вы удивитесь, сколько всего можно выболтать, комментируя чужие комментарии. Да еще этот полезный обычай отмечать друг друга - если ты забудешь написать, где побывал, другие позаботятся. Человек такое социальное существо.
  Успехи, однако, закончились на имени, контактном коде и месте учебы. Местом проживания значились "поиск и перемены", личным статусом - "сингл". У что-то-там-колледжа оказались три здания в разных местах, год обучения и группу уточнить не удалось. Хобби - цветы, кошки, экономика, фотографировать море. Любимый ресторан - сетевая кофейня, каких в городе минимум десяток, без уточнения адреса. Мероприятия - посещения кинотеатров и лекций. Культурная девушка. Но склонная к импровизациям: запланированных на будущее мероприятий - ноль. Друзья... несколько сотен, девушки в шальварах среди них, кажется, нет. Участие в сообществах - кошки, цветы, цветы, селекция, биология. Чтение по подписке - те же темы. Никаких подсказок, где можно девушку случайно встретить и намекнуть, что врать старшим нехорошо и бесполезно. Никаких разъяснений, зачем она назначает встречи незнакомым людям.
  Это было странно. Человек существует, он не призрак, не какой-нибудь нелегал, и в то же время его нет. Конечно, автоматический перевод делает поиск неуклюжим, но ведь и задача простая. Чтобы не ловились ни место проживания, хотя бы с точностью до улицы, ни места учебы, работы, тусовок - это большая редкость, или параноик, или глубокий интроверт. Если только...
  Если только дева не училась тому же, что и ты, детектив Островски. Открой свой блог - что там у тебя? Стенолазание, скалолазание, виртуальная стрельба, немного пикапа, немного пинапа, карикатуры на политиков, фотографии девушек, шутки на офисные темы. Типичный такой конторский крыс с одним-двумя умеренно экстремальными хобби, тоже своего рода аватар. Если кто-то захочет узнать о тебе побольше, отсутствие следа в Сети покажется подозрительным. Блог надо иметь, нельзя без блога. Но когда пишешь очередной пост, некоторые вещи привычно опускаешь или заменяешь. Чтобы никаких "в баре на нашей улице" или "из моего окна". И тем более - ничего о настоящей работе.
  Гулять Сергею расхотелось. Захотелось оказаться в четырех стенах, где можно раскрыть большой экран, и никто (это важно) не будет пялиться через плечо. К тому же на съемной квартире, в чемоданчике под замком остался блокнот с некоторыми кодами, которые они использовали на тренинге и которые, возможно, еще не потеряли актуальности.
  
  ***
  
  По сравнению с Нью-Йорком какой угодно город выглядит трогательно маленьким, но старый Стокгольм, в границах начала ХХ века, - по любым меркам крошечный. Похоже, в нем не нашлось бы двух точек, отстоящих друг от друга более чем на десять станций метро. Если тогда здесь было метро.
  Овервея в Стокгольме и сейчас не было. Подземные поезда казались умилительно старомодными, но при этом надежными, как швейцарские часы. Не способные опоздать более чем на десять секунд, бесшумные даже в туннеле, чистые и кондиционированные, с широким выходом во Вселенскую паутину, заботливо предупреждающие о приближении станции. Сергей не взялся бы повторить то, что произносил милый женский голос в динамике, - шведские слова ему не давались. Он просто запомнил, что его станция начинается на "О".
  Однако же чуть ее не проехал, потому что разглядел интересное. Нора-Кристин подписалась на обновления его знакомого по лунной миссии, немецкого биоинформатика. То, что знал о нем Сергей, в основном укладывалось в три слова: "крупный ученый, бабник". Содержание блога соответствовало.
  Для любительницы цветов и кошечек такая подписка - на грани фола. В открытых постах, посвященных науке, а не женщинам, сам Сергей понимал не более одного слова из четырех. Может, чисто девичий интерес, к мужчине, а не к ученому? Дело возможное, и старина Эрвин любит молоденьких. У него в перемещениях Стокгольм не числится, сидит в своем Мюнхене с самого момента скандальной отправки на Землю, но виртуальное общение двух совершеннолетних людей пока никто не запрещал. И все же странно...
  
  
  Квартирка Оскара находилась в милейшем районе: уже не туристический центр, еще не клетушки высотных зданий конца прошлого века. Буржуазному стилю, кирпичу и металлическим кровлям, широким тротуарам и зеленым дворикам странно противоречили названия улиц. Тут был весь скандинавский пантеон, от Одина до малоизвестных Хеймдаля и Видара, и никого, кроме туристов, не удивляла сухощавая чопорная церковь на улице бога плодородия Фрейра.
  Только теперь он заметил объявление на заборчике, шведский текст дублировался английским и почему-то русским, и снова запрещалось пользование индивидуальными устройствами для полета. Запрещалось там много чего еще, и тоже, наверное, все такое, что нормальному человеку в голову не придет.
  Солнце еще стояло высоко, и сверкающие окна отбрасывали квадраты бледного света на теневую сторону улицы. Дом был в трех шагах от метро, никакой навигатор не нужен. Первый этаж занимала детская школа творчества, витрину украшали пестрые надписи и детские работы: голубые ромашки, лиловые розы, ветвистые одуванчики. Что-то живьем цвело в горшках, что-то было представлено фотографиями. Сергей и Оскар вчера встретили здесь руководительницу этой школы. Хрупкая дама с голубыми волосами (тоже генетическая модификация или все-таки краска?), поджав губы, фотографировала собачью кучку на мощеном тротуаре и тыкала в нее одноразовым "градусником". Социально активные пожилые леди везде одинаковы: отправить ДНК-штрихкод в полицию, чтобы животное пробили по базе, вкатили хозяину штраф и заставили пересдавать какие-нибудь тесты на право владения домашним любимцем, - дело святое.
  Квартирка была в мансарде над девятым этажом, с двумя окнами. Вероятно, век назад это был чердак, где жильцы сушили белье. Но сейчас апартаменты выглядели свежо и уютно: гладкий деревянный пол, атласные панели на стенах, на окошках цветастые занавески, апельсинового цвета кровать с мягчайшей периной. Все дешевое, зато новенькое или по крайней мере чистое.
  Сергей чуть не споткнулся о баллоны и сопла, разложенные на полу. Осматривал перед уходом, проверял, все ли в норме, - шведы люди добросовестные, но мало ли, - и оставил заряжаться электронику: аккумуляторы пустые, а процесс небыстрый. Надо бы его упаковать, пока не заглянул главный по дому или какой-нибудь сосед, если всех здесь так волнуют полеты... Ладно, потом.
  Предположим для развлечения, что девушка и вправду детектив, сотрудник полиции либо какого-нибудь другого департамента. А может быть, наоборот, нарушительница закона? Нет, для начала возьмем версию с хорошей девочкой. Как вычислить по открытым данным человека, работающего под прикрытием, или в чем хранить универсальный растворитель... Было бы здорово найти у нее в контактах местных коллег, знакомых по тренингу, хоть того же Оскара. Но увы... Особенно греет, что источники на шведском языке. Хотя и не все, многие сообщения содержат по два коротких текста, шведский и английский.
  Сергей забрасывал невод снова и снова, и раз за разом получал кучу мусора. Исчерпав простые методы, перешел к непростым, затем к очень специфическим, затем к только что изученным, - зеро! В какой-то момент поймал себя на том, что скручивает волосы в узелок на затылке и нашаривает заколку-сетку. Автопилот собрался в спортзал? Ладно, в любом случае пора прерваться, два последних запроса были явно бесполезными, от отчаяния.
  Он подошел к окну, взглянул на маленькую площадь. Прохожих мало: старик на велосипеде, женщина с маленькой рыжей собачкой, молодой папаша катит коляску с двумя детьми... У-упс! Сергей потряс головой, поморгал, пытаясь перезагрузить изображение. Не помогло. Коротко стриженная девица в шальварах, расписанных цветными клетками, вела за руку другую, в белой майке и коротких джинсах, с широкой белой повязкой на глазах. Люди оглядывались на подружек, играющих в забавную игру, улыбались.
  Первым побуждением Сергея было бежать на улицу, но тут девушки дошли до светофора и приготовились переходить. С дальней стороны тротуара на ближнюю. Надо было хотя бы посмотреть, в какую сторону они пойдут; пока спущусь, могут куда-нибудь свернуть. Интересно, где они шлялись все это время, они на машине, я пешком и на метро, и еще успел посидеть в Сети...
  Они никуда не свернули. Они направились в его дом, в соседний подъезд. Сергей чуть не вывалился из своего окна, но разглядел, как открывается дверь и две фигурки заходят внутрь.
  Да что ж такое-то?! Близок локоть, а не укусишь. Может, вылезти и пройтись по фасаду на "гекконах", найти окно?.. Ага, до первого звонка в полицию от аборигенов. Значит, выйти и стеречь снаружи, едва ли она здесь заночует. Или вывесить на окне видеокамеру - кто запретит туристу снимать улицу? - и ждать...
  Сергей замер, прислушиваясь. Из-за стены доносился голос. Из-за тонкой внутренней переборки слева, разгораживающей чердак. Слов не разобрать, но звук, тембр... нет, это уже чересчур. Это судьба, от которой, как известно, не уйдешь.
  Он вытащил "длинное ухо", поводил щупом вдоль балки. Должна же тут где-то быть щель... Есть щель.
  Два голоса. Ее и мужской, не старый, лет до тридцати. Слышимость прекрасная, но проку с этого ноль. Переводчик, а переводчик, вот тебе аудиодорожка... что-что? Какую программу купить и установить? Мужчина что-то объяснял, теперь замолчал. Говорит Нора-Кристин, долго говорит, три-четыре фразы, спокойно и вроде бы слегка насмешливо... Пошли вы с программой. Переткнуть ухо на внешний звук, переводчик разговорной речи, давай, родной. Нора-Кристин что-то спрашивает, кажется, она удивлена. Второй девицы не слыхать, молчит, а может быть, вышла.
  Переводчик загрузился, добросовестно прислушался, вычерчивая сонограмму, в окошке побежали строчки.
  "Но это преступление".
  "Ты ждать мелкое правонарушение?"
  "Я ждать плохая игра".
  "Можно сказать так. Кто-то скажет плохо, кто-то скажет хорошо. Так, если это игра, ты не будешь ярость что проиграть?"
  "Почему?"
  "Я не могу разрешить ты уйти".
  "Это глупо. Мы следим вас".
  "Нам нужно мало время. Пока вы следите, я делаю это осталось. Ты будешь здесь".
  "Ты убьешь меня?"
  "Я не знаю. Кто это знает точно. Ты будешь первая, может быть. А может быть, нет, если ты хорошо. Дай мне твой вифон"...
  Сергей медленно опустился на пол, положил вифон на колени. Вот тебе и приключение с девушкой. Преступник или псих. Или то и другое.
  Думай, Островски, думай. Звонить в полицию? Тот сказал "мало времени".
  Окно. Старомодное мансардное окошко под круглой кровелькой, покатый карниз за подоконником. И такое же окно рядом. Неизвестно, сколько их там, псих сказал "нам", а у тебя даже ствола нет, детектив на отдыхе в культурной стране. Вот если бы не соваться туда вообще... И за какое время ты успеешь втащить девушку на крышу? А тот будет стоять и смотреть с одобрением? Мало шансов.
  Сергей оглянулся и увидел то, что было разложено на полу.
  Сами накликали, сукины дети. Если бы не эти бесконечные напоминания, я бы придумал что-нибудь другое, а сейчас нет времени перебирать варианты. Плевал я на штрафы, деньги есть. Да может, и обойдется?
  Хорошо, что не убрал в рюкзак. Защитные штаны надеть нужно, а то хорош будет Капитан Америка с поджаренной задницей. Тапочки для болдеринга. Десять секунд. Баллон, сопла. Тридцать секунд. Пояс и рюкзак. Джет-белт, верхние и нижние пряжки. Минута. Где снаряга?! Вот. Страховочный трос на пояс, перчатки-"гекконы" на руки. Полторы минуты. Вы сами псих, офицер. Я в курсе, офицер, но отступать поздно. Вифон за пазуху, во внутренний карман. Вперед.
  Окно открылось бесшумно, хорошее окно. Пригибаясь, чтобы не отсвечивать на фоне неба, и стараясь ступать мягко, он двинулся вправо. Ничего страшного, с улицы меня не видно, люди редко смотрят вверх, разве что в окна кто-то глазеет, ну и не беда, главное - никто не успеет помешать. А вот здесь у них черепица не закреплена, прихватим ее с собой.
  Забраться на соседнее окно. Трос, закрепленный на поясе, перекинуть через шею, справа налево, надеюсь, что она правша. Если она та, за кого я ее принимаю, то в ухе у нее капсула для голосовых сообщений, ее не так просто заблокировать, даже отобрав и вырубив вифон. Не факт, что она может что-то передать в ответ, но по идее, на эту капсулу идут сообщения с открытого контактного кода, который я нашел в Сети... Идут! По крайней мере, сигнал приема есть.
  - Нора? Если хочешь уйти отсюда, постарайся открыть правое окно. Я брошу тебе липкую веревку, хватай и ничего не бойся. Жду. Конец связи.
  Встать спиной к краю. Трос, свернутый в бухту, держим в руке, кусок черепицы за пояс. Ерунда, я уже так вытаскивал грузы, и людей поднимал. Правда, не в полете. Но по управляемому полету сдал все тесты, инструктор звал дальше учиться... Правда, летал только один. Ну или вдвоем, но с инструктором, который управлял движками. Сколько времени ждем?..
  Звук открываемого окна. Сергей прыгнул назад и резко взял на себя оба рычага.
  - Держи! - проорал он изо всех сил, швыряя трос в окно. В визге реактивного движка тонули все прочие звуки. До чего же он громкий, раньше не замечал, и нет, пожалуй, без штрафа не обойдется. Он увидел Нору - глаза у нее были огромные, кажется, она что-то кричала, но главное - схватилась за веревку. В глубине комнаты - человек, замер и попятился, протягивая назад руку... н-на! В голову не попал, попал в корпус, ну и ладно: клиент получил куском кирпича, я получил пару секунд... Вверх и немного назад! Молодец девчонка, только зачем было ногами так отталкиваться?.. Движок негодующе завыл, внезапные сорок-пятьдесят килограммов и болтанка не пришлись ему по душе. Ничего, выдержишь, нам через море не лететь и рекордов скорости не ставить, по документам у тебя расчетная перегрузка плюс шесть...
  - Молимся и падаем!
  Автонатяг троса, движки к нулю. Тело теряет вес, и другое тело прилетает снизу - как будто качаешься на тарзанке и с размаху приложился о товарища. Ее руку трос поднял на шею, теперь никуда не денется. Движки на среднюю.
  - Молодец! Ногами за ноги держись, не за пояс! И не дергайся!
  Так, что теперь? План был - опуститься обратно на крышу и влезть в окно. Но пока мы бултыхались, из-за крена нас отнесло вверх и в сторону, и продолжает нести, она меня наклонила вперед... вот дерьмо, и где теперь наша крыша? Коричневая с мансардами... их тут три, четыре, пять, а улица-то которая?! Мощность движков на полную, но ее уже не хватает. Они возносились над крышами на вершине невидимого майского шеста, и он кренился, опора проседала...
  - Ты спятил?! Мы сейчас разобьемся!
  - Спокойствие. - В качающейся картинке далеко внизу под ногами Сергей высмотрел зеленый бугор - тот парк на холме, где маленький пруд, обсерватория и библиотека, и как раз на склоне за библиотекой небольшой пустырь. Очень вовремя, они теряли высоту все быстрее, и таймер начал пикать, предупреждая, что топлива осталось меньше чем на минуту. - Спокойствие, только спокойствие...
  ...Словно распаковался архив в голове. Подходящий момент, чтобы догадаться, почему запрещено летать и почему именно над районом Вазастан! Сказка, переведенная со шведского, мультфильм, не известный никому из американских ребят, книжка в руках у мамы - "В городе Стокгольме, на самой обыкновенной улице..." Да, нехорошо получилось, не поверят в полиции, что мы не нарочно, я бы на их месте не поверил, особенно если это не первый случай... Вероятно, он подтвердил все предположения Норы на его счет, когда начал смеяться.
  Посадка получилась сравнительно мягкой. Эта сторона холма заросла дикой травой, и публики тут не было, только в самый последний момент Сергей оттолкнулся ногой от старой каменной стенки, внезапно выскочившей перед ними. Наклонившись в нужную сторону, он отключил движки, бросил рычаги и прижал девушку к себе, и они рухнули в бурьян.
  Стало тихо. Совсем тихо, будто под одеялом. Потом кто-то передвинул регулятор громкости, и возник шум машин, отдаленные крики, шелест ветра. Над их головами покачивался огромный зеленый лист лопуха. Пахло травяным соком, от ее кожи - солнцем и какими-то цветами, и напряжение отпустило, сложно треснул хитиновый панцирь. Нора оказалась совсем легонькой и хрупкой. Узкая спина под его ладонями, дыхание, громкий стук сердца... Сергей повернул голову, чтобы заглянуть ей в лицо, - и тут же она рванулась у него из рук.
  Никакого там полуобморока, никакого благодарного трепета. Губы сжаты, в глазах ярость. Валькирия, которую коварно унес с поля боя неизвестно кто. Она толкнула его в грудь, задергала рукой, которую все еще держала веревка.
  - Тише, тише, - сказал Сергей, - оторвешь мне голову. Тут "липучка" на конце, ее надо ослабить, а не натягивать. Вот так. Больно? Прости, по-другому не получалось.
  Что дальше? Еще раз извиниться? В стране победившего феминизма мужчина должен просить прощения даже за то, что получилось случайно и с добрыми намерениями...
  - Извини.
  - Кто ты такой?! Ты врал, что американец, ты русский!
  Я русский?.. Да, те три слова на последних метрах снижения были русскими, отрицать невозможно.
  - Очень мне нужно врать, - ответил он. - Моя мама русская, отец американец, я гражданин Соединенных Штатов, не надо меня убивать... Эй, а ты? Я думал, ты шведка.
  Наконец-то она улыбнулась.
  - Мама из Петербурга, вышла замуж за финна, потом мы переехали сюда. Но... ты кто? Почему ты знаешь мой контакт, и это у тебя откуда? - она махнула рукой на джет-белт.
  Сергей пожал плечами.
  - Твой контакт я нашел в открытых источниках, и не спрашивай зачем. В соседней комнате оказался случайно, я там живу - за стенкой у того типа, к которому ты пришла. Ранец взял в аренду, чтобы летать над морем, такое у меня хобби... Кстати, не подскажешь, во что этот полет мне обойдется?
  И не вспомнишь ли, что должны говорить хорошие девочки, когда их спасают от злодеев... Не вспомнила. Охнула, прижала руки ко рту и одним движением вскочила на ноги.
  - Что? Мне светит пожизненное?
  - Н-нет... - Она остановилась и заморгала, что-то просчитывая. - Нет, только штраф... Серж... могу я тебя попросить?
  Надо же, имя вспомнила.
  - Слушаю.
  - Не говори в полиции, что летел со мной, скажи, что был один! Придумай что-нибудь, пожалуйста! - она шагнула к нему и даже сложила руки перед грудью, как ребенок, наряженный ангелочком. - Пожалуйста! Мне надо бежать, это очень срочно!
  - Ладно. Все сделаем, не волнуйся. Да что за паника? Кто этот тип, за которым ты...
  - Некогда! Я тебя найду потом, честное слово! Спасибо! - привстала на цыпочки, поцеловала его в щеку - по-настоящему коснулась губами, а не скользнула скулой о скулу. И тут же отпрыгнула, выскочила на тропинку, которая спускалась из парка на улицу, и скрылась за углом какого-то одноэтажного сарая между холмом и улицей.
  Кто этот тип, кто ты сама? Точно ли ты хорошая девочка, Нора?.. Сергей вздохнул и принялся расстегивать пряжки летательной сбруи. Только он успел выбраться из нее, как с другой стороны, от библиотеки, на тропинке появились двое полицейских.
  
  
  ...Сергей Островски. Соединенные Штаты. Туризм и обучение, виза до пятнадцатого августа. Я очень сожалею, сам не знаю, как это вышло, клянусь! Хотел только проверить движки, выбрался на крышу, и вот... Должно быть, перепутал режимы. Да, сдавал тесты. Да, информационные письма получал. Я сожалею. Целиком моя вина. Второй человек? Какой второй человек? Офицер, ему показалось, этого не могло быть, движки рассчитаны на одного. Вижу помятые лопухи. И лопухи, пожухлые от горячего выхлопа, вижу. Понимаю. Очень сожалею. Хорошо. Я готов заплатить. Заблокировать сумму штрафа прямо сейчас? Как скажете.
  В общем, Сергей догадывался, что полет над Вазастаном стоит дороже, чем неправильная парковка, но когда он увидел сумму на экране, у него вырвался звук, похожий на "хып". И ощущение было - как будто с размаху двинули под ложечку. Он заметил, что кормленые стокгольмские полисмены ухмыляются, потихоньку перевел дух и сам улыбнулся во все зубы, выражая удовольствие от благополучного разрешения конфликта. Ничего страшного. Минус поездка на острова, минус день на Готланде, минус маринованная лососина под полынную водку и концерты в клубах. В молодые годы бывало хуже. Жилье и обратный билет оплачены, на еду много не уйдет. А с развлечениями у меня и так все хорошо.
  - Мы вынуждены забрать ваше техническое приспособление и вернуть его собственнику. Вопрос о возврате денег за аренду вы можете обсудить с представителями фирмы.
  Еле удержавшись от "о, спасибо большое", Сергей со смиренным видом подал джет-белт полицейскому. Видеть он эту штуку больше не желал. Отныне только болдеринг.
  Гордись, Островски. Самая дорогая женщина в твоей жизни. Тридцать секунд целомудренных объятий, и уже такие расходы. Может, стоило все-таки рассказать полиции и про Нору, и про того, кто сидит в соседней мансарде? Этот мысленный вопрос был чисто теоретическим. Пока он не мог бы сказать, верит Норе или нет, но знал, что называть ее имя не будет.
  
  ***
  
  Термоустойчивые штаны от костюма для полетов были радикально серебряными, будто слеплены из фольги. Примерно в такой одежде просили подаяния ряженые у туристов в пешеходной зоне. Не то чтобы это было совсем неприемлемо на общем фоне стокгольмской уличной моды, но вопросы об адекватности, очевидно, вызывало. Напротив дома какие-то люди в оранжевых комбинезонах тащили в сторону тяжелый чугунный люк, кажется, собирались спуститься под землю. Двое тащили, а третий, видимо, их начальник, уставился на Сергея круглыми глазами, потом ухмыльнулся и вытащил мобильный телефон. Сергей поторопился зайти в подъезд.
  Как и не уходил, только джет-белта на полу больше нет. За стеной тихо, ни шагов, ни разговоров, лишь гудит на одной ноте что-то вроде кондиционера. Сергею показалось, что он слышит какую-то возню: щелчок, звяканье стекла. Он побродил по комнате, выглянул в окно... так-так. Похоже, Нора оказалась хорошей девушкой.
  У дома стояла группа полицейских. Один из них уже давал объяснения пожилой леди с голубыми волосами, делая указующие жесты прочь от подъезда. Неподалеку припарковался мультивэн, надпись на борту непонятная, зато устройство на крыше знакомое: внутри, значит, передвижная лаборатория с автономным кондиционированием.
  Интересно, а работяги в оранжевом тоже их коллеги? Чтобы тот тип не убежал через подвал? Из мансарды? Или это обычные ремонтные службы именно сейчас занялись какими-то своими делами... Погоди, Островски: ты его слышишь, полиция готовится его брать, значит, уличные видеокамеры не зафиксировали его ухода, и он все еще здесь, за стенкой? А какого хрена он все еще здесь? Как только мы улетели, он должен был подхватиться и бежать, сейчас был бы уже в метро, например, и никто не знал бы, на какой ветке. Почему-то думал, что Нора не вызовет полицию? Но она сказала "преступление", уж в этом-то переводчик не мог ошибиться, и еще сказала, что за ним следят... А он ответил... что-то про "немного времени", про то, что ему что-то осталось доделать. И теперь он делает это, зная, что его сейчас будут брать. Что же такое у нас "это"?..
  О-о черт.
  Преступное дело, которое надо доделать хотя бы и под нацеленными стволами, кошечки, цветочки и старина Эрвин в интересах, детская студия внизу и даже квартира Оскара за стенкой - да все же сходится, кретин! Сергею показалось, будто он снова падает с высоты девятиэтажного дома, руки и ноги стали как чужие. Что же они тянут, здесь люди кругом, брать его надо прямо сейчас, всего-то одна хлипкая стенка... Ах да, это я за стенкой, а они внизу. Но раз уж я рядом, попробуем чем-нибудь его развлечь.
  Резак в рюкзаке из-под джет-белта. Молекулярное лезвие, способное в долю секунды перехватить кевларовые ремни. Для нештатной ситуации, когда падение в море с высоты предпочтительнее дальнейшего полета. Оружием не считается, а зря.
  Стена, отгораживающая его квартиру от соседней, не была капитальной, то-то и слышно через нее было хорошо. Обычные декоративные панели, закрепленные в балочных рамах от пола до потолка. Красивые панели, в нежный цветочек, на ощупь как шелковые, наверняка дорогие. Сергей аккуратно обвел лезвием одну панель, наклонил и вытащил. Под ней оказался ворсистый пласт грязно-белого цвета - звукоизолирующий материал, и сразу стало слышнее ровное гудение. Тут же были: электрический кабель, проложенный между панелями, сетевой кабель, еще какая-то требуха. Он прикинул, где находится источник звука, кивнул сам себе и ударил резаком по кабелю.
  Гул затих.
  За тонким листом пенокартона, прямо над ухом у Сергея, кто-то произнес несколько слов. По-щведски, но смысл понятен: что, мол, за внезапный и досадный непорядок?! Сергей ухмыльнулся и бесшумно ступил в сторону, на всякий случай держа резак наготове.
  Дальше произошло неожиданное. Что-то трескуче зашелестело, на картонной стенке светлым контуром очертился небольшой квадрат, затем кусочек стены исчез, и человек по ту сторону замер в недоумении. Сергей не стал ждать, пока он налюбуется внезапно открывшимся интерьером Оскаровой квартиры, а просто ударил ногой в стену. Вернее, в то, что от нее оставалось.
  Пенокартон треснул, за ним что-то рухнуло с грохотом. Второй удар выломал достаточно большой кусок, и Сергей сунулся в пролом, держа наготове резак. Человек скакнул в сторону, однако уронить его простым зацепом оказалось совсем легко, и схватить ствол он не успел. Крепкий парень, но драке не обученный.
  - Тихо, - сказал Сергей. - Понимаешь по-английски? Вот молодец.
  Он дернул за ближайший шнур на полу. На другом конце оказался какой-то приборчик, но Сергея пока интересовал только шнур.
  - Давай руки.
  Даже если драться этот тип не умеет, оставить его руки свободными было бы крайне опрометчиво. А по виду и не скажешь. По виду настоящий скандинавский бог: светлые волосы двумя крупными волнами надо лбом, ясные глаза, молодая бородка, затейливая татуировка на накачанном плече. Нейропистолет на тумбочке - с виду обычный "дайрин", самооборона без необратимых последствий.
  - Кто еще в квартире?
  - Никого. - Тенорок, высоковатый для такого мускулистого красавца. Это он говорил с Норой, точно. Смотрит только на резак, не отрывая взгляда. - Я один, правда.
  - Допустим. Теперь посмотрим, что тут у тебя. - Сергей потянул его за футболку, помогая подняться на ноги, потом толчком усадил на стул. Огляделся и переливчато свистнул. Все было верно.
  Приборчик на полу - мини-терминал с расколотым корпусом, упал, когда я шел сквозь стену, наверняка "двойняшка". Рядом лабораторный стол. Вскрытая упаковка одноразовых пробирок, штативы, автоматические пипетки, мини-центрифуга (похоже, ее-то песню Сергей и прервал), еще какой-то прибор, весы, толстостенная ванночка со льдом. Холодильник, термостат и, о да, кофеварка.
  - Гаражный биотех, твою мать... Прошу прощения. Чердачный, конечно. - Сергей стоял так, чтобы видеть дверной проем: вдруг кто-то все же затаился на кухне или в ванной комнате. Зафиксировать этого понадежнее и заглянуть туда? Нет, сначала поговорить. - И что варим? Говорящий йогурт или трехмесячную простуду?
  - Ты кто? - спросил юный Бальдр.
  - Друг девушки, которую ты обидел, - ответил Сергей. - Очень сердит на тебя, так что не выделывайся. Я задал тебе вопрос.
  - Ты еврей.
  Сказал он это так, словно открыл что-то важное и крайне неприятное для противника. Сергей даже растерялся. У каждого человека есть национальность и этническая принадлежность, но когда детектив Островски кому-то сильно досаждал, он обычно оказывался "этим русским". Хотя бывало, что и "гребаным хитрым евреем", а в Москве, само собой, "американцем", тоже с эпитетами. Он подхватил с пола резак и шагнул в сторону пленного, проворачивая нож в пальцах. Юный Бальдр побледнел, однако продолжал свое:
  - Евреи должны жить в Израиле.
  Не ушиб ли я ему голову? Впрочем... татуировка на плече - переплетения узоров и руны. Древними алфавитами Сергей не увлекался, но руна "зиг" ему была знакома. Похоже, повреждение в мозгах не аппаратное, а программное.
  - Не говори мне, что я должен делать. Вопрос.
  Бородатый красавчик светло улыбнулся.
  - А я тебе ответил. Я сделал штуку, которая очистит Север от вас. Евреи отправятся в Израиль, черные - в Африку, желтые - в Азию. Останется только исконное население.
  - Биологическое оружие? - Сергей стрельнул взглядом в сторону лабораторного стола, ощутил страх и разозлился на себя за это.
  - Не-ет. Мученики террора были героями, но это двадцатый век. То, что я сделал, это просто фактор отбора. Люди могут ошибаться, уничтожать невинных или за взятки позволять черным черепушкам делать, что они хотят, но вирус ты не обманешь. Вирусная оболочка со специфическими лигандами, в ней малые РНК против митохондриальных генов... ты все равно не поймешь. Вы просто не выдержите нашего короткого светового дня, начнете болеть и умирать. Или все помрете от рака, или уедете к себе, в ваши джунгли и пустыни, туда, где вам место. Европа станет свободной, сама очистится от вас.
  Он вскинул связанные руки. Между большим и указательным пальцем у него была полупрозрачная капсула, и прежде чем Сергей успел дернуться, пальцы сжались, капсула лопнула с тихим щелчком, и в воздухе растворилось легкое облачко. Или померещилось - вирусы же невидимы, так?..
  - Евреи должны жить в Израиле, - наставительным тоном повторил юный Бальдр, и не успел он договорить, как входная дверь ударилась в стену, и чердачную комнату заполнили люди в масках и спецкостюмах. Зашипели аэрозольные баллоны, покрывая сплошной полимерной пленкой лабораторный стол, кто-то выругался, увидев дыру в стене, Бальдра поставили на ноги и принялись обыскивать, другие накинулись на Сергея с расспросами. Стараясь говорить четко и ясно, он дважды рассказал все, что знал. Было странно обращаться к собеседникам, у которых закрыты лица, - видны только глаза и брови сквозь полосу синеватого пластика.
  Привыкай, Островски.
  Он продолжал говорить, а сам осознавал, во что влип. Евреи должны жить в Израиле, вот ведь затейник. В Израиле Сергей бывал. Ему даже понравились закат над морем и раннее утро в Иерусалиме. А потом он решил прогуляться по городу днем, - подумаешь, сорок градусов, - и пришел в сознание под полосатым тентом лавки, в которую не заходил; какие-то люди мочили его водой и трясли, пытались добиться ответов на непонятные вопросы, а потом отец хозяина лавки провожал его до отеля, бурча под нос что-то про бестолковых туристов, которые себе думают, что им тут Флорида...
  Подтвердив, что все понимает и со всем согласен, он влез в защитный шлем с забралом - не такой, как у группы биобезопасности, прямо противоположного назначения, - и протянул руки под струи распылителя. Пленка была толстой и жесткой, хотелось ее немедленно содрать, но его заверили, что это только до госпиталя. И как бы там ни было сурово, в том спецбоксе, или куда его поместят, уж койка-то найдется. Повезло, что вифон в кармане.
  
  ***
  
  откуда взялся этот американец? почему увязался за тобой?
  он жил в квартире юландера, я же объяснила. почему увязался, вам лучше узнать у него
  ))))))))
  (no reply)
  ок, прости. на самом деле я тебе обязан, ты молодец. самый паршивый вариант - одинокий волк, и какая хитрая сволочь. я выяснил: ферменты, олиги и прочие расходные материалы он заказывал вместе с детской студией госпожи лундстен. один и тот же ассортимент, одна доставка, адрес ее, оптом дешевле. пришить бы старой дуре соучастие
  а запросы по биотехнологиям делал через юландера, якобы с его узла?
  точно. здорово устроился. а ты как вышла на тех девиц?
  закрытая женская сеть, личные темы, регистрация по пяти рекомендациям. одна похвасталась, что знает парня, который божественно трахается и занимается запрещенной наукой ))) любит блондинок и готов на все, если ему немного помочь в работе
  ********!!!
  йенс!
  я должен был сказать - какой плохой человек? он хотел, чтобы они распространяли вирус?
  не знаю. думаю, блондинок он выбирал не случайно. может быть, заставил бы их проглотить по капсуле, сделал бы первыми носительницами - раз блондинки, значит, не заболеют
  он не рассказывал им, что задумал?
  он и мне не рассказывал ))) был удивлен, когда я стала цитировать его файлы. он даже не запаролился как следует, я прямо при нем и вошла со своего
  OMG зачем ты туда полезла одна????
  я же не знала. думала, он забавляется с NO-синтазой или чем-то таким )))
  ))) да, он же секс-монстр
  что он делал, когда его взяли? уже определили?
  ну, откровенно говоря, ему оставалось выполнить два последних пункта протокола. потом мы получили бы активный вирус
  то есть американец успел вовремя?
  (no reply)
  йенс?
  вовремя ((( но если с ним что-то серьезное, ты понимаешь. такого скандала не было лет десять
  я сейчас в госпитале, поговорю с его врачами
  потом отпишись мне
  ок
  Нора Хейно, сотрудник департамента биобезопасности Федерального института прогнозируемых рисков, закончила разговор с непосредственным начальником как раз вовремя: в холл вернулась медсестра.
  - Проходите, доктор Вильнер подойдет через пять минут.
  Большую часть комнаты за дверью отделяла стеклянная перегородка. Нора на секунду растерялась: кровать в боксе была пуста. Русский американец сидел на полу у стены, вытянув одну ногу и пристроив вифон на колене другой. Больничная пижама странно контрастировала с черными волосами ниже плеч. И выражение лица, подсвеченного экранчиком, было не как у пациента. Не слишком веселое, но рабочее.
  Нора постучала в стекло - но это было не стекло, вышло почти без звука. Ах да, переговорное устройство.
  - Серж!
  Он увидел ее и тут же вскочил, с такой изумленной улыбкой, будто не верил, что она придет. Произнес что-то - кажется, ее имя. Нора показала на переговорник, он радостно закивал и схватил микрофон.
  - Нора. Ты не обиделась на меня?
  - За что?
  - Ну, я, наверное, не должен был вмешиваться в твою работу.
  Сказано было так смиренно, что она улыбнулась.
  - Если бы ты не вмешался, все было бы плохо. И потом, это я с тобой заговорила первой. Там, на набережной.
  - А почему? Почему со мной - ты ведь ждала ту девицу?
  -Я узнала тебя. Вычислила квартал, где живет подозреваемый, посмотрела записи с уличных камер за предыдущий день. Тебя запомнила: ты сначала прошел с обычным чемоданом, а второй раз с рюкзаком - в нем была эта ракета, да? А потом увидела тебя у точки встречи. И ты еще обошел вокруг статуи - Леа, та девушка, тоже должна была это сделать. Я решила, что ты от них.
  - Случайность, - американец усмехнулся. За ночь он осунулся и побледнел, или так казалось из-за синевато-белого света.
  - Случайность.
  - А я очень испугался за тебя, когда услышал вас за стенкой. Как твоя рука?
  - Рука хорошо, почти не болит. Но ты ненормальный. У нас в департаменте есть чокнутые, но таких ни одного.
  - Спасибо! - он отступил на шаг, чтобы изобразить поклон. И снова подошел ближе, чуть ли не прижался носом к прозрачной перегородке. И она не решилась отступить, чтобы не обидеть его.
  - Как твои дела? Что говорят врачи?
  - Говорят: "Посмотрим", - Сергей развел руками. - Ждут результаты анализов из квартиры. Когда поймут, что это, тогда скажут, что мне делать... Ну-ну. Спокойствие, только спокойствие.
  Он погладил стекло напротив ее щеки. Нора положила на стекло свою ладонь, словно он действительно мог до нее дотронуться и она хотела удержать его руку.
  - Но это не... это не может быть что-то серьезное?
  - А, не думаю, - беспечно ответил он. - Ваш красавец - самоучка, гаражный гений. Едва ли у него было несколько крутых разработок. Верней всего, я получил то же, чем он угрожал всем, и с шансами - незаконченное. В самом худшем случае не смогу жить в северных широтах. Хотя это было бы грустно.
  - Да, у тебя же родные в России?
  - Ага. И нет, не поэтому.
  Он смотрел ей в глаза, не отрываясь. Голос через динамик - как будто он далеко, но расстояние было не больше, чем когда они упали на холм, связанные веревкой. Она поняла, что краснеет, и он улыбнулся.
  - Нафига ты сунулся к нему во второй раз?!
  - Ну-у... я ведь правильно понял, что времени больше нет.
  - Мог бы позвать с собой наших! У них есть средства защиты, наверняка можно было бы объяснить...
  - Нора, ты так волнуешься. Жалеешь меня? Почему?
  - Почему?.. Дурак.
  Это она сказала по-шведски, отвернувшись от микрофона. Понял он или нет, осталось неизвестным.
  - Здравствуйте, господин Островски. Почему вы еще тут?
  - А где я должен быть?
  - В нашем офисе, оформлять документы. Да выходите, дверь разблокирована. Эксперты не нашли там ничего, никаких искусственных генетических конструкций, никаких белков, ничего страшного вообще. Ни в квартире, ни в самой капсуле. Очевидно, он блефовал. Ваши анализы в норме, транскриптомы еще делают, но это так, для очистки совести.
  Сергей, уже открывший дверь, замер на пороге в некоем замешательстве.
  - Транскриптомы... Вы уже отправили мне счет?
  - Боже упаси. Помощь пострадавшему при террористическом акте, счета не ваша забота. Выходите, выходите, господин Островски, все позади.
  - Доктор, с ним действительно все в порядке? - спросила Нора по-шведски.
  - В соответствии с возрастом и стилем жизни, - важно ответил доктор. - Не беспокойтесь, госпожа Хейно.
  - Вот видишь. Я говорил, что со мной все будет хорошо?
  - О...
  - Я не понимаю, вы только от меня об этом узнали? Нильсон?! - Доктор обернулся к сопровождающему. - Какого черта вы ему не сообщили сразу?
  - Я с... - начал молодой человек, но американец через голову девушки подмигнул ему обоими глазами и приложил палец к губам. - М-м, я, наверно, не успел.
  - Не успели. По вашей милости, Нильсон, человек лишние полчаса готовился к худшему, а вы тем временем пили кофе...
  Нильсон слушал доктора, косил одним глазом ему за спину и делал заметки на будущее, никак не связанные с медицинской этикой. Зрелище было скорее смешное, учитывая разницу в росте этих двоих, и все же завидно... Наконец доктор тоже оглянулся.
  - Ага. Международное сотрудничество, - сардонические нотки в его голосе, к счастью, относились уже не к Нильсону. - Скажи ему, чтобы забирал свои вещи и выматывался, тут им не мотель. И проводи в офис, пускай заверит документы.
  
  ***
  
  - Бюте тилль туннел-бана мут, - старательно артикулируя и запинаясь, выговорил Сергей. - Что это значит?
  - Пересатттка на линию метттро, - с серьезным видом ответила Нора.
  - Ну вот, дразнится. Я стараюсь, а она дразнится.
  Эта ветка была больше надземкой, чем подземкой, и вот уже минут пять вагон катился под ярким утренним солнцем. Сергею хотелось обнять Нору, но она не любила нежностей на людях. Ей, бедной, немало сил приходится тратить на то, чтобы вызывать у мужчин реакцию, отличную от "ми-ми-ми". Такая обманчиво хрупкая, трогательно кудрявая, с чистыми глазами... с жизненным опытом вроде его собственного в ее возрасте. В двадцать пять лет он еще работал в полиции. А она вдобавок магистр биологии.
  Квартирку на Оденплан ему пришлось освободить. Оскара срочно выцепили из Упсалы и заставили объясняться: как, черт побери, он мог не заметить, что с его узла идут левые запросы? (Наверное, те, кто об этом спрашивает, сами каждый час проверяют свою историю просмотров, чисто на всякий случай.) Сергею было слегка неловко, и за то, что все так вышло с биотеррористом, и за дыру в стене. Но ему теперь было где жить оставшиеся пять дней. То есть уже четыре.
  Что дальше? Ну, это не сейчас. Во всяком случае, не сегодня. Такую работу, как у нее, запросто не бросают, и детективов в Швеции хватает своих, и все это пока преждевременно... преждевременно, Островски, понял? Как сказал один старый насмешник, осталось еще уговорить принцессу.
  Принцесса в новой белой майке и джинсовых шортах, читающая почту в вифоне, была прекрасна. Ее профиль безупречен - точеный носик и мягкие губы, ее лицо в летней полутени светится само, будто мрамор или яшма, живым розовым светом. Сергей осторожно положил руку ей за спину и только успел подумать, что маневр сошел благополучно, как она повернулась к нему.
  - Что?
  - Ничего. Йенс пишет про Эрлинга.
  - Про кого?
  - Эрлинг Кнутссон - наш вчерашний подопечный. Тебе интересно?
  - Еще бы! Хорошие новости?
  Она помотала головой.
  - Одна плохая, одна философская, и одна не знаю какая.
  - Начинай с плохой.
  - Это была не первая его разработка. Первую он успел выпустить, но она, во-первых, действует только на выходцев из Сомали - их сравнительно легко проверить, а во-вторых, практически не вирулентна.
  - То есть опасна, но не заразна?
  - Да. И это вторая новость: руки у него кривые, конструкцию он создал ущербную. Даже если бы он доделал вторую, она бы тоже повредила только тем, кто ее вдохнет или проглотит. Вряд ли кому-то еще, от человека к человеку она передавалась бы очень слабо.
  - То есть мы зря нервничали?
  - Обидно, да? - Нора толкнула его локтем и состроила рожицу. - Ничего не зря. Если бы биооружие было так просто сделать, зачем бы государство содержало целые исследовательские центры? Но психов-одиночек лучше ловить, чем... чем не ловить. И потом, тех, кто проглотил бы, тоже жалко, пусть их и мало. Почти всех.
  - Почти? А кого не жалко?
  - Это третья новость. (Новая гримаска.) Сам Кнутссон.
  - Что Кнутссон? Он что, тоже...
  - Несчастный кретин. Был настолько уверен в чистоте своей крови, что не оттипировался и не принимал никаких мер безопасности.
  - Во как. Может, он ненормальный?
  - Защита будет доказывать, что да, но, по-моему, просто идиот. Похоже, среди его предков по материнской линии были валлоны.
  - Это еще кто?
  - Такой народ, европейский, но ни разу не арийцы. Их много в Швеции. Теперь, наверное, придется переводить его в какую-нибудь тюрьму в другой стране, на юге.
  - Ривьера подойдет? Нежности какие... хотя Сомали - тоже неплохой вариант.
  - Сережа!.. Мы выходим, следующая наша.
  - Ты прямо сейчас на работу?
  - Да.
  - Тебе не попадет из-за меня?
  - Нет, что ты. Йенс говорит, что против одиноких волков лучшее средство - одинокий охотник. Начертил тучу графиков, сегодня будет всем объяснять, что такое работа на опережение и почему она не удается большим коллективам.
  - Ага. И почему удалась...
  - ...Постороннему иностранцу, который был совсем не в курсе!
  - Мне просто повезло. Случайно попал в нужное место.
  - Значит, мы должны воспроизвести случайность и везение.
  - Ого! Зря надеетесь, меня воспроизвести невозможно.
  - Такая работа. Надо думать. Агенты под прикрытием, охотники за головами нелегальных биотехнологов. Может быть, массовое волонтерство...
  - В вашей службе?
  - Сама в афиге. (Русский язык Норы по интонациям и словарному запасу отличался от ее же английского. Надо полагать, ее мама не принадлежала к высшему свету Петербурга, но Сергею было все равно.) Нет, наверное, это чересчур, но что-то в этом роде. Чем больше людей понимает, как это делается, тем меньше шансов делать это незаметно.
  Рассуждение показалось Сергею спорным. "Дети, запихивать кошку в мультиварку плохо! - Ладно, не будем, но спасибо за идею". К некоторым вещам лучше не привлекать избыточного внимания, подражатели преступников всегда были проблемой. Впрочем, специалисты по прогнозируемым рискам, наверное, сами это понимают?
  - Забавно, раньше не думал об этом, - сказал он вслух. - На самой обыкновенной улице, в самом обыкновенном доме любой тронутый наци может выращивать опасный вирус, как какую-нибудь герань... Может, для начала запретить расистов?
  - Что ж вы у себя не запретили? - ядовито спросила Нора. - Обычно они не докладывают, что, мол, собираются убить всех черных, - те, которые действительно собираются. И кстати, для сведения: этой весной у нас было аналогичное расследование, только фигуранты - африканцы. Сознательно передавали друг другу ослабленный вирус болезни Бардере. Симптомы похожие, результаты анализов тоже, но нелетальный. От ребенка к ребенку, каждая семья выбирала одного.
  - Не понял: своим детям давали вирус?
  - Своим, своим. Семьям больных детей продлевают вид на жительство. А вирус как бы неопасный, тоже один умелец сделал. Ну как неопасный: во-первых, вирусы быстро мутируют...
  - Теперь понял. Ну и работа у тебя.
  - Ла-адно, - протянула Нора, - кто бы говорил. А ты что будешь делать, пойдешь гулять?
  - Угу.
  - Обязательно посмотри корабль "Васа". Или в ратушу сходи, туда тоже можно по туристической карте... что ты смеешься?
  - Хотел сказать "я просто погуляю по центру, как позавчера".
  - Я тебе погуляю, как позавчера! - она тоже засмеялась. - Иди смотреть кораблик, это познавательно. Куртку надень, а то простудишься, там холодно в музее.
  Еще раз поцеловала его и ушла по тротуару, прочь от набережной. Обернулась, помахала рукой. Куртку надень, а то простудишься. Ни одну женщину в мире до сих пор не интересовало, достаточно ли тепло он одет. Ну, кроме мамы, конечно.
  Солнце поднималось выше, с пролива задувало, вода в нем из голубой становилась синей. Сергей оглянулся на краснокирпичный фотографический музей, сообразил, где гулял вчера, и пошел в том направлении. Надо чего-нибудь съесть, а то у Норы дома только три сорта мюсли и простокваша, женский цыплячий корм. Зато шампуней у нее тоже три сорта, и еще она мне предложила какие-то снадобья, которыми женщины обрабатывают волосы после мытья, и невсерьез обиделась, когда я начал хохотать, а потом сама меня причесывала. Вот будем жить вместе, я буду варить ей кофе и научу готовить яйца по-венски. А если она вдруг заболеет, то принесу в постель молоко с медом и коньяком... нет, лучше пусть она никогда не болеет. Вообще надо ей заканчивать с этой биобезопасностью, не желаю думать, что ей опять подвернется какой-нибудь псих с вирусом. Так и скажу: мы планируем серьезные отношения, может быть ребенок, и ты не должна... Нет, Островски, это ей не понравится. Лучше так: тебе надо делать карьеру, нельзя до бесконечности бегать по мелким поручениям, пора переходить от оперативной работы к аналитике. Я хочу, чтобы ты всегда была в безопасности, слышишь?..
  - ...А? Да, простите. Капучино о каннельбуле.
  Не заметил, как подошел к ларьку и задумчиво уставился на плакатик-меню. Интересно, сколько раз девушка за прилавком его окликала.
  Это что-то новенькое. Нет, кончено, влюблялся и раньше, и бывало, что донимали всякие неделовые мысли и ощущения посреди рабочего дня. Но чтобы, как мальчишка в очках виртуальной реальности, не замечать ничего вокруг, погрузиться в мир, которого на самом деле нет, говорить с воображаемой Норой, - такого до сих пор не случалось. Кофе, кофе.
  ...Надо узнать, как у них в Швеции делают предложение. Продемонстрировать серьезные намерения. Деньги понадобятся, конечно, без этого ни в одной стране. Колечко с бриллиантом - ерунда, а как это Оскар говорил - у приличного человека должны быть три В, вилла, "вольво" и "вау", то бишь собственная собака? Дом куплю. Почему нет, другие люди покупают недвижимость, и я куплю. Сколько можно мотаться по съемным квартирам. Мама будет счастлива. Дом в пригороде, зеленые жалюзи, флагшток на лужайке перед крыльцом. Дети. Здесь у многих по трое. Кхм... ничего, справимся. И собака, если нужно, хоть десять собак, как скажешь, дорогая...
  Так сходят с ума? Сергей Островски, муж и отец, владелец собственного дома в штате Теннеси и десяти собак. А ведь ты даже еще не знаешь, кто ты для нее.
  Большая чайка взлетела с набережной, повернула против солнца, маховые перья вспыхнули белизной. Сергей вспомнил сегодняшний сон. Норины белые шторки почти не задерживали летний утренний свет, а в освещенных комнатах всегда снится правдоподобная ахинея. Они снова висели над Стокгольмом, реактивная тяга поднимала их выше и выше, и он видел город внизу, как наяву не успел разглядеть, во всех подробностях. Рыжие и темно-серые крыши ощетинились мансардами, башенками, трубами; пятна зелени, цветные точки машин и людей, синяя полоса воды - а потом движение мучительно замедлилось, они замерли, балансируя в верхней точке, перед тем, как рухнуть в каменное море, и на этом месте его тряхнуло и выбросило из сна. Нора издала недовольный звук, не открывая глаз, ухватила его за палец и сунула его руку себе под щеку.
  ...Ага: поднимаемся, насколько хватает тяги, изменяем мир и себя, технологии, потребные для этого, делаем доступными кому попало, независимо от адекватности и личных убеждений. Не то чтобы какие-то судьбоносные открытия, вроде ядерной энергии или природы наследственности. Просто все новые и новые игрушки, новые приложения для гаджетов: опознать биообъект, отредактировать геном биообъекта, восстановить функции, добавить новые... Новые игрушки для все тех же глупых детей.
  Но тот, кто сначала поднимется на большую высоту, а потом выключит движок, убьется наверняка. Единственный приемлемый выход - учиться летать. Пусть не так грациозно, как чайки, но как-нибудь. Равновесие сил, вот что важно.
  Сергей скомкал чашку с блюдечком и швырнул в урну. Познавательный исторический кораблик подождет. Где-то в Старом городе, там, где бегут с горки вымощенные брусчаткой улочки, бронзовый дракон, как перевернутый на спину кот, отпихивает коня святого Георгия задними лапами, а бедная дева с ног до головы опутана плющом, - там, если не врет навигатор, есть сувенирная лавка с серебряными безделушками несерьезного дизайна. Что-нибудь смешное и милое, ни к чему не обязывающее и в то же время с намеком. Русал и русалка. Или спираль ДНК. Или маленькая сыщицкая лупа на цепочке. Стоп мечтать, и вперед. Четыре дня - это уйма времени, многого можно достичь, если не зевать.
  
  Примечания автора: "Откуда она это взяла"
  
  Подражая классикам твердой НФ, я решила поместить в конце небольшой комментарий со ссылками на источники, которые помогали мне придумывать фантастические допущения. Возможно, диванные эксперты по переднему краю науки, прочитав это послесловие, воздержатся от комментариев о том, что в слюне нет никакой ДНК, а если память пропала, то ее уж не восстановить. Хотя диванные эксперты редко дочитывают до конца. На самом деле я пишу это для тех, кому интересны научные обоснования фантастических технологий и прочее в этом роде.
  
  Днем рождения ДНК-криминалистики, очевидно, следует считать 10 сентября 1984 года, когда Алек Джеффрис из Лестерского университета (Великобритания), взглянув на электрофореграммы ДНК своего лаборанта и его родственников, изобрел ДНК-фингерпринт. Этот метод позволял идентифицировать личность индивида, оставившего биоматериал, а также устанавливать родственные связи - например, приходится ли А отцом Б, - с доселе невиданной достоверностью.
  Возможности метода сильно расширила полимеразная цепная реакция, открытая Кэри Мюллисом (Нобелевская премия по химии 1993 года). Она позволяет снимать копии с исчезающе малого количества ДНК - сотен, а то и десятков пикограммов, то есть геномов горсточки клеток. Из считанных молекул, содержащихся в образце, можно получить количество, достаточное для анализа. Затем появились методы секвенирования нового поколения, и следующего за новым поколения - вдаваться в детали не буду, но время, когда прочтение полного генома станет медицинской и полицейской рутиной, уже виднеется на горизонте. А пользы от этого тем больше, чем больше мы знаем о разнообразии генома человека. Пусть тут будет несколько ссылок:
  https://en.wikipedia.org/wiki/Human_Genome_Diversity_Project
  https://en.wikipedia.org/wiki/1000_Genomes_Project
  https://en.wikipedia.org/wiki/International_HapMap_Project
  https://en.wikipedia.org/wiki/Human_Variome_Project
  Что можно делать уже сейчас? Например, пол идентифицируют по гену амелогенина, белка, который экспрессируется в зубной эмали при формировании нового зуба. Его гены имеются и в X, и в Y-хромосоме, и они отличаются по размерам: "мужской" вариант длиннее. Если есть Y-хромосомный вариант гена амелогенина - значит, образец принадлежит мужчине, если его нет - значит, женщине... или мужской вариант потерялся, поэтому используют и другие маркеры пола. Определение этнической принадлежности/географического происхождения (естественно, не гражданства и не паспортной национальности) возможно с некоторыми допусками и оговорками: глобализация тут много напутала, если бы мы по-прежнему жили маленькими племенами, каждое со своим тотемом и своими брачными обычаями, было бы проще. Исследование Y-хромосомы и митохондриальной ДНК позволяет проследить происхождение человека по отцовской и материнской линиям, со всеми вытекающими преимуществами и осложнениями.
  Существуют генетические варианты, которые довольно четко ассоциируют, например, с рыжим цветом волос и характерной для рыжих светлой кожей. Однозначно реконструировать черты лица по геному пока не удается, но ученые работают, думаю, через полвека все будет (PLOS Genetics, 2014, 10, 3, e1004224, doi: 10.1371/journal.pgen.1004224). Что касается возраста, тут может помочь уровень метилирования ДНК (Nature, 2014, 508, 168-170, doi: 10.1038/508168a).
  Благодаря методам анализа ДНК 7 июля 2010 года в Лос-Анджелесе был арестован знаменитый Grim Sleeper, убийца 12 человек. Под подозрение попал 57-летний Лонни Дэвид Фрэнклин, бывший работник гаража и уборщик, когда в ДНК его сына, арестованного за незаконное хранение оружия, выявили совпадения с ДНК неизвестного убийцы. Агент полиции сыграл роль официанта в ресторане, где ел Фрэнклин, забрал тарелки, приборы, стакан и корки от пиццы. На обкусанных корках нашлось достаточно ДНК, чтобы продемонстрировать ее полное совпадение с генетическим материалом маньяка (Science, 2010, 329, 5989, 262, doi: 10.1126/science.329.5989.262).
  А вот еще был случай: злодея уличили по его вирусу. Жил в испанском городе Валенсия врач-анестезиолог Хуан Маэсо, на вид приличный человек, а на самом деле наркоман. Воровал у пациентов морфий, причем делал себе инъекции той же иглой и, как выяснилось позднее, был носителем вируса гепатита С, который и передал множеству людей. Пытаясь оспорить обвинение, Маэсо прибег к следующему аргументу: где доказательства, что этих людей заразил он? А может, это он получил вирус от пациента! Доказательства предоставила молекулярная филогения. Вирусы эволюционируют быстро, их геномы всегда немного отличаются между собой. Анализ определенных участков геномов вирусов, полученных у пациентов клиники, подтвердил, что 275 из 322 заразились от доктора-морфиниста. Закрыли его надолго, и это правильно (BMC Biology, 2013, 11, 76, doi: 10.1186/1741-7007-11-76, русский пересказ http://biomolecula.ru/content/1215).
  Бывают и накладки. В 2004 году в Австралии за убийцу приняли женщину, которая на самом деле была жертвой: ее одежда исследовалась в той же лаборатории, что и улики с места убийства. И еще прекраснее: в 2005 году в США мужчину обвинили в изнасиловании, тогда как настоящим насильником оказался донор костного мозга, который пересадили подозреваемому.
  А может быть и не ошибка, а злой умысел. Опыты по фабрикации биоматериала, содержащего чью надо ДНК, уже проводились и были признаны успешными (Forensic Science International: Genetics, 2010, 4, 2, 95-103, doi: 10.1016/j.fsigen.2009.06.009). Так что техническая возможность так подставить человека - имеется. Отличить фальшивую ДНК можно по уровню метилирования, если фальсификатор не позаботится и об этом.
  Можно сказать, что паранойя по поводу доступа к генотипу гражданина имеет основания. В США с 2008 года действует Акт о запрете дискриминации на основе генетической информации (Genetic Information Nondiscrimination Act, или GINA). Согласно этому акту, наниматели не имеют права требовать у сотрудников ДНК на анализ, а также принимать на основании генетических данных кадровые решения, в том числе о найме, увольнении и продвижении по службе. Разумно? Вроде да. Но вот свежий случай применения этого акта - "тайна хитрого дефекатора".
  В некой логистической компании из штата Джорджия возникла проблема: кто-то из сотрудников, видимо, обиженный компанией, повадился гадить на складе. В прямом смысле. Компания отправила на экспертизу биоматериал и попросила двух сотрудников, подозрения против которых были самыми сильными, сдать ДНК на анализ. Обоих подозреваемых ДНК-экспертиза оправдала. Через некоторое время они подали на своих нанимателей в суд за посягательство на генетическую приватность. Теперь с компании в пользу "пострадавших" будут взысканы 2,25 млн. долларов (Nature, 25 июня 2015 года, doi: 10.1038/nature.2015.17857, Nature Biotechnology, 2015, 33, 675, doi:10.1038/nbt0715-675b). А кто хулиганил на складе, осталось неизвестным. Вот такой ДНК-детектив с открытым финалом...
  Все это я рассказываю для тех, кому показалось, что возможности выдуманных мной криминалистов, а также законы о защите ДНК-приватности чересчур фантастичны. Не фантастичны вообще. Так, легкая аппроксимация. Запас баек на тему "DNA in court" я не исчерпала, но пора и честь знать.
  
  Генные варианты, связанные с высоким интеллектом, ищут, но успехи трудно назвать блестящими (навскидку: Molecular Psychiatry, 2015, doi: 10.1038/mp.2015.108, 2011, 16 (10), 996-1005. doi: 10.1038/mp.2011.85). А такой эффект, как в "Луне...", - это, сознаюсь, фантастика. И близко нет ничего подобного. С другой стороны, принципиального запрета нет: высокая наследуемость интеллекта показана, и если сейчас человек на Земле самый умный из всех животных (с некоторыми очевидными оговорками), то почему бы однажды не возникнуть еще более мощному уму? Можно предположить, что в поумнение будет вовлечен некий регулятор, изменяющий активность сразу множества генов. Вероятно, не обойдется без метилирования ДНК. Так я думаю своим немодифицированным умом. Пожалуй, стоит когда-нибудь еще вернуться к этой теме.
  
  Лапки геккона ученых завораживают. Надеюсь, появление биомиметического материала для перчаток на их основе - вопрос времени. Не так давно было чудесное исследование: измеряли силу, которую нужно приложить, чтобы оторвать от гладкой поверхности гекконов живых и гекконов мертвых (Biology Letters, 2014, 10, doi: 10.1098/rsbl.2014.0701). Никакого особого вклада "жизненной силы" в прочность сцепления не было обнаружено, если не считать, что геккон регулирует ее, изменяя положение пальчиков. Кстати, так мы и думали.
  
  Не собиралась писать про лунные технологии, но тут не могу промолчать: патент на агрегат для приготовления газированных напитков в невесомости существует на самом деле (http://patents.su/3-1526567-sistema-dlya-prigotovleniya-putem-smeshivaniya-i-vydachi-napitka-v-usloviyakh-kosmicheskojj-nevesomosti.html).
  
  Кодирование обычных текстов четырьмя буквами ДНК имеет долгую историю. По-видимому, первую такую работу еще в конце прошлого века выполнили люди из Медицинской школы Маунт Синай в Нью-Йорке (Nature, 1999, 399, 6736, 533-534, doi: 10.1038/21092.). Поставив в соответствие нуклеотидным триплетам буквы алфавита, они синтезировали молекулу, в которой была записана одна из главных военных тайн ХХ века: "JUNE 6 INVASION:NORMANDY", то есть дата высадки союзников в 1944 году. Кодовую таблицу составить нетрудно, проблема - достаточно мощное и доступное устройство синтеза ДНК. Но и к этому мы приближаемся. Более того, фрагмент гениального романа уже вставлен в геном бактерии! В 2010 году команда Крейга Вентера объявила о создании существа с синтетическим геномом - точнее, они ввели синтетическую ДНК в клетку бактерии (https://en.wikipedia.org/wiki/Mycoplasma_laboratorium). В этот геном, среди прочих пасхалок, поместили отрывок из "Портрета художника в юности": "To live, to err, to fall, to triumph, to recreate life out of life" - "Жить, заблуждаться, падать, торжествовать, воссоздавать жизнь из жизни". И (честное слово, не знала об этом, когда писала "Дело об украденной трилогии"!) тут же получили письмо от правообладателей Джеймса Джойса (http://blogs.discovermagazine.com/loom/2011/03/15/copyright-law-meets-synthetic-life-meets-james-joyce/). До судебных исков не дошло, ученым просто сказали: ай-яй-яй, могли бы и спросить разрешения, прежде чем вставлять великие строки в вашу гадость. Наследники Фейнмана и Оппенгеймера, тоже попавших в микоплазму, насколько мне известно, не возмущались.
  
  Передача данных высокочастотным мерцанием светодиодов - совсем не фантастика, гуглить Visible Light Communication (VLC) или Li-Fi.
  
  Даже не буду обижать читателей, рассказывая о возможностях 3D-печати. Объекты сложной структуры, импланты разного рода, фигурные кусочки сахара,- все это уже в новостях. Вот недавно разрешили пилюли печатать на 3D-принтере (Nature Biotechnology, 2015, 33, 1014, doi:10.1038/nbt1015-1014a) - одна из тех вещей, которые мне в голову не приходили.
  
  Инженерные органы для шестого чувства вполне реальны. Так, в лаборатории Мигеля Николелиса в университете Дюка, где делают, вообще говоря, много полезного для писателей-фантастов, создали крыс, осязающих инфракрасный свет (http://www.nicolelislab.net/?p=345).
  
  Управление памятью - стремительно развивающееся направление. В 2015 году исполнилось десять лет методу, который позволяет избирательно, по желанию экспериментатора, активировать нейроны, отвечающие за определенное воспоминание (Nature Neuroscience, 2015, 18, 1213-1225, doi:10.1038/nn.4091, и другие статьи в том же номере). Возможность включать и выключать память продемонстрировали Теодор Бергер с соавторами из UCLA и университета Уэйк Форест - они сделали чип, функционально замещающий участок гиппокампа у крысы (публикаций на эту тему у них много, см., напр., Journal of Neural Engineering, 2011, 8, 4, doi: 10.1088/1741-2560/8/4/046017). "Поверните рубильник, и крысы вспомнят. Выключите его, и крысы забудут", - объяснял журналистам доктор Бергер. А вот свежая новость о том, как подбираются к человеку (http://emb.citengine.com/event/embc-2015/paper-details?pdID=4697, русский пересказ http://www.neurotechnologies.ru/articles?id=16). Гиппокамп и Альцгеймер, ага.
  
  Болезнь Чена я выдумала, но понятие о коннектопатии - не выдумала (см. напр. Brain, 2014, doi: 10.1093/brain/awu276). Бороться с нейродегенеративным заболеванием аппаратными методами пока, очевидно, рановато, но по мере появления новых электродов (Neuron, 2015, 86, 175-186, doi.org/10.1016/j.neuron.2014.12.035) и совершенствования обработки сигналов это может стать реальным. Конечно, проект амбициозен до предела, и это одна из причин, по которым я поместила его в Россию. Кое-кто сочтет выбор место действия излишне оптимистичным, но я считаю, что предпосылки есть.
  
  Модификация человеческого генома, в том числе и по внешности. Надеюсь, читатели еще не забыли недавнюю сенсацию - как китайские ученые сделали это с эмбрионами человека, выбракованными при экстракорпоральном оплодотворении и нежизнеспособными (Protein & Cell, 2015, 6, 5, 363-372, doi: 10.1007/s13238-015-0153-5). Китайцы использовали знаменитые "молекулярные ножницы" CRISPR-Cas9, в которых фрагмент РНК наводит конструкцию на нужный участок ДНК, а белок делает в этом месте разрез. Эффективность и точность метода, однако, не впечатлили, с человеком все оказалось сложнее, чем с животными. Но только алармисты с облегчением констатировали, что бодливой корове рогов не дадено, как была представлена новая, более точная система для редактирования генома млекопитающих (и журналисты тут же исправили mammal на human) - CRISPR-Cpf1 ("Cell", 2015, doi: 10.1016/j.cell.2015.09.038).
  
  Гамбургер из мяса, выращенного в культуре, уже был изготовлен и съеден ресторанными критиками (http://www.bbc.com/news/science-environment-23576143). Правда, пока он дороговат. О, а вот сайт, где предлагают гамбургеры из мяса знаменитостей (http://www.bitelabs.org/), если это не фейк и если лавочку не прикроют к моменту выхода книги. Вот так сделаешь в салоне маникюр с педикюром, а через месяц в супермаркете появятся котлеты из тебя... Нет, только засекречивание геномов граждан и уголовная ответственность за хищение биоматериалов спасут мир!
  
  С джет-белтом - реактивным ранцем для индивидуального полета - все не так замечательно, как хотелось бы. Летают недолго и опасно. Но могу я наконец помечтать? Лет через 70, может быть, все-таки справятся?
  
  Про гаражный биотех замечательно рассказал по-русски Антон Чугунов на Биомолекуле (http://biomolecula.ru/content/831), не думаю, что я могу что-то к этому добавить. Да, все это можно устроить у себя дома.
  
  Биологическое оружие - штука страшная. Тут я открытых ссылок на научные исследования не положу (и сама не читала), но разговоров в кулуарах не для публикации за годы работы научным журналистом наслушалась достаточно. Естественные возбудители заболеваний; они же модифицированные и в различных комбинациях; онкогенные вирусы; прионы; живые организмы с иной биохимией, а-ля монструозная глубоководная жизнь из "Морских звезд" Питера Уоттса... Одно утешение - этническое биооружие (https://en.wikipedia.org/wiki/Ethnic_bioweapon) определенно слишком сложно, чтобы его мог разработать нацист-энтузиаст на коленке. Если вообще возможно, велят добавить читатели.
  
  На этой оптимистической ноте закончим. Научная фантастика жива, и кто сумеет, пусть делает лучше нас!
  
  2015
  
  Благодарности
  
  Первым побуждением было скопировать сюда целиком мои френдгруппы "наука и научная журналистика" в ЖЖ и Фейсбуке. Это было бы правильно во многих отношениях - не вся информация, полученная от френдов, вошла в книгу, но все вошли в мое сердце, и они делают каждое мое утро. Однако это была бы подмена органической памяти техническими средствами. Решила вот что: назову по именам всех, чьи материалы, посты и перепосты, так или иначе повлиявшие на меня во время работы, смогу вспомнить.
  
  Прежде всего благодарю команду "Химии и жизни", особенно Любовь Стрельникову, Леонида Ашкинази, Веронику Благутину, Сергея Комарова, Наталью Резник, наших авторов и Юлию Ивановну Зварич, многие годы лечившую меня от кавычек и отточий; братскую "Науку и жизнь", "Кота Шрёдингера", "Троицкий вариант", Биомолекулу, Антропогенез, Элементы, Постнауку, Открытую науку; Антона Первушина, Александра Хохлова, Александра Ильина и всех, кто думает об освоении космоса; Веру Башмакову, Сергея Белкова, Виктора Вагнера, Аркадия Курамшина, Романа Кутузова за "Вадемекум", Надежду Маркину, Алексея Паевского, Руслану Радчук, Алексея Торгашева, Антона Чугунова, Дена Тулинова, Марину Фридман, Владимира Фридмана... и все-таки - всю научно-популярную френдленту.
  
  Также благодарю родных и друзей, помогавших вычитывать книгу.
  И всех учителей, врачей и ученых, кого еще не назвала, из всех стран - просто за то, что вы есть.
Оценка: 8.24*8  Ваша оценка:

Связаться с программистом сайта.

Новые книги авторов СИ, вышедшие из печати:
Э.Бланк "Межзвездный мезальянс. Право на ошибку" С.Ролдугина "Кофейные истории" Л.Каури "Стрекоза для покойника" А.Сокол "Первый ученик" К.Вран "Поступь инферно" Е.Смолина "Одинокий фонарь" Л.Черникова "Невеста принца и волшебные бабочки" Н.Яблочкова "О боже, какие мужчины! Знакомство" В.Южная "Тебя уволят, детка!" А.Федотовская "Лучшая роль для принцессы" В.Прягин "Волнолом"

Как попасть в этoт список
Сайт - "Художники" .. || .. Доска об'явлений "Книги"